H3k27me3

ChIP–qPCR was performed from neural progenitor cells (NPCs) as previously described (Bovio et al, 2019 (link); Ferrari et al, 2020 (link)), with minor changes in composition of buffers: Lysis buffer for EZH2 (10 mM EDTA; 50 mM TRIS–HCl pH 8; 0.2% sodium dodecyl sulphate (SDS) and 1× protease inhibitor), lysis buffer for H3K27me3 (10 mM EDTA; 50 mM TRIS–HCl pH 8; 1% SDS and 1× protease inhibitor), dilution buffer (20 mM TRIS–HCl; 2 mM EDTA; 150 mM NaCl and 1% Triton). All ChIP–qPCR experiments performed with NPCs were generated from V6.5 mESCs as described (Ferrari et al, 2020 (link)), cultured on 1 × 10 cm cell culture dishes and treated for 48 h with 10 μM EPZ or 0.1% DMSO as control. Approximately 6 million cells were used in each ChIP experiment. 3 μg of IgG (#2027, Santa Cruz), 5 μg of H3K27me3 (#39155, Active Motif, USA), 5 μg of EZH2 (#39901, Active Motif) or 3 μg of DOT1L (#77087, Cell Signaling) antibody was used. Significant differences in H3K27me3 and EZH2 binding to the selected locus were calculated between EPZ and control using a one‐sided paired Wilcoxon statistical test. Results from NPC ChIP–qPCR experiments are from a minimum of five independent replicates. The following primers targeting the transcriptional start site (TSS) on Asns were used:

ASNS_TSS_fw: TCCCGCTTACCTGAGCACTA

ASNS_TSS_rv: CAGCCACATGATGAAACTTCC

Cells were lysed in ice-cold RIPA cell buffer (P0013B, Beyotime Biotechnology, China) supplemented with protease inhibitor cocktail. The proteins (40–100 μg) were separated on 10–15% PAGE gels and electrotransferred onto polyvinylidene fluoride membranes. After blocking with 5% skimmed milk, the membrane was incubated with specific primary antibody and horseradish peroxidase-conjugated secondary antibody. The antibodies used are Flag (GNI4110-FG-S, GNI, Japan, 1:1000), HA (GNI4110-HA-S, GNI, Japan, 1:1000), Stat3 (12640S, Cell Signaling Technology, USA,1:1000), phospho-Stat3^Y705 (9131S, Cell Signaling Technology, USA, 1:1000), Socs3 (sc-73045, Santa Cruz, 1:1000), Prdm14(D221722, BBI, China, 1:1000), H3K27me3 (39055, Active Motif, China, 1:1000), H3 (4620s,Cell Signaling Technology, USA, 1:1000) and β-Tubulin (200608, ZENBIO, China, 1:2000). The band density was analyzed with ImageJ according to ImageJ User Guide. Briefly, we inverted the greyscale images and select sample bands with rectangular selections. The proteins levels were normalized with respect to the β-Tubulin level, and the grayscale ratio of protein/β-Tubulin was calculated and visualized with GraphPad Prism 8.0.