gDNA was extracted from cells using the JetQuick Blood and Cell Culture DNA Midiprep Kit (Thermo Fisher). PCR was then used to amplify the sgRNA inserts and append Illumina adaptors and hexamer barcodes to the amplicons. See Supplemental S8 for primer sequences and thermocycling. PCR was performed using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs). Before creating the amplicon library, dPCR was used to assay the copy number of sgRNA inserts in extracted genomic DNA. Sufficient genomic DNA template was used to ensure a minimum read depth of 300 per sample. PCR products were then pooled, concentrated by isopropanol precipitation, and gel purified on a 2% agarose gel before sequencing. Gel extraction was carried out with the PureLink Gel Extraction kit (Thermo Fisher). The purified, barcoded amplicon libraries were then pooled and sequenced as single-read 50 bp reads on the Illumina HiSeq 4,000 (Illumina).
Purelink gel extraction kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PureLink Gel Extraction Kit is a laboratory product designed to extract and purify DNA fragments from agarose gel slices. It provides a simple and efficient method to recover DNA from gel for downstream applications such as cloning, sequencing, or further analysis.
Automatically generated - may contain errors
Lab products found in correlation
T4 dna ligase, by New England Biolabs (2 mentions)
Platinum taq hi fi, by Thermo Fisher Scientific (2 mentions)
Qiaquick pcr purification kit, by Qiagen (2 mentions)
Q5 hot start high fidelity 2x master mix, by New England Biolabs (1 mentions)
Hiseq 4000, by Illumina (1 mentions)
1 dna sequencer, by Thermo Fisher Scientific (1 mentions)
High fidelity taq polymerase, by Thermo Fisher Scientific (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Sanger sequencing, by Eurofins (1 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
Pfastbac vector, by Thermo Fisher Scientific (1 mentions)
Gateway bp clonase 2 enzyme mix, by Thermo Fisher Scientific (1 mentions)
Gateway lr clonase 2 enzyme mix, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator cycle sequencing reaction kit, by Thermo Fisher Scientific (1 mentions)
Abi prism 3700 dna analyzer, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna blood mini kit, by Qiagen (1 mentions)
Genelute hp plasmid miniprep kit, by Merck Group (1 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (1 mentions)
Phusion flash high fidelity master mix, by Thermo Fisher Scientific (1 mentions)
Kapa biosystems library quantification kit, by Roche (1 mentions)
15 protocols using purelink gel extraction kit
1
CRISPR Library Preparation and Sequencing
2
LOKV Sequence Verification by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing were performed to verify LOKV sequences generated by high-throughput sequencing and to close gaps between contigs. Complementary DNAs were generated using Superscript III reverse transcriptase (ThermoFisher) and PCRs were performed using high-fidelity Taq polymerase (ThermoFisher) in accordance to the manufacturer’s instructions. Primers were designed from the sequences generated by high-throughput sequencing and are available upon request. RT-PCR products were purified using the purelink gel extraction kit (ThermoFisher) and sequenced using a 3730 × 1 DNA sequencer (Applied Biosystems, Foster City, CA).
3
TMUV Envelope Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 1503-bp amplicon covering the entire TMUV envelope gene was amplified using the primers TMUV-E_F (5′-TTCAGCTGTCTGGGGATGCA-3′) and TMUV-E_R (5′-GGCATTGACATTTACTGCCA-3′). PCR amplification was conducted from 2 µL of cDNA using Q5 High Fidelity DNA Polymerase (NEB, Évry-Courcouronnes, France) and the following parameters: 98 °C for 1 min, 40 cycles of 98 °C 10 s, 60 °C 15 s, 72 °C 60 s and 72 °C for 2 min. PCR products were visualized on 1.5% agarose gel, and amplicons were gel-purified using a PureLink Gel extraction kit (Thermo Fisher Scientific, Illkirch-Graffenstaden, France) and stored at −20 °C. Purified amplicons were sequenced via Sanger sequencing in both forward and reverse directions (Eurofins, Vergèze, France).
4
ATRX cDNA Cloning and Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ATRX cDNA was amplified by PCR and the DNA band was excised and purified using the PureLink Gel Extraction Kit (Thermo Fisher Scientific, K210012) and introduced into pDONR223 using Gateway BP Clonase II Enzyme mix (Thermo Fisher Scientific, 8602289719), as well as a pFastBac vector (ThermoFisher Scientific) for expression in insect cells. pDONR223 plasmids containing CCDC71 and FAM207A were generated in the laboratory of Dr. Anne-Claude Gingras. Plasmids were prepared using Stable Competent E. coli (NEB, C3040I). Clones were selected from LB agar plates (1% tryptone, 0.5% yeast extract, 170 mM NaCl, pH 7.5) containing 50 μg/mL spectinomycin. ATRX was subcloned into a pDEST vector containing an N- or C-terminal FLAG-BirA* using Gateway LR Clonase II Enzyme mix (Thermo Fisher Scientific, 11791020). Transformed cells were selected on LB agar plates with 50 μg/mL ampicillin. The pDEST-pcDNA5-RAP1-BirA*-FLAG-C-term plasmid was prepared in the laboratory of Dr. Anne-Claude Gingras. Lentiviral particles encoding myc-tagged SLF2 were prepared in the laboratory of Dr. Grant Stewart.
5
Mitochondrial Genome Sequencing of LHON Patients
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from LHON patients and control subjects was extracted using a DNA extraction kit (QIAamp® DNA Blood Mini kit; Qiagen GmbH), according to the manufacturer's protocol. The complete mitochondrial genomes of II-5, II-7, II-12 and III-8 were amplified in 24 overlapping fragments using 200 µM dNTP, 10X buffer, Taq DNA polymerase and 15 mmol/l Mg2 (cat. no. R004A; Takara Biotechnology, Co., Ltd.). The 24 sequences of light-strand and heavy-strands oligonucleotide primers for amplification of mtDNA genes were used according to a previous report (14 (link)). The following thermocycling conditions were used for PCR: 95°C for 5 min; 30 cycles of 94°C for 10 sec, 60°C for 30 sec and 72°C for 1 min; and a final extension at 72°C for 5 min. After confirmation of band of interest, the PCR products were purified using the PureLink Gel Extraction kit (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's recommendations. DNA samples with concentrations >1.0 ng/µl were sequenced using the BigDye™ Terminator Cycle Sequencing reaction kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) and an ABI PRISM® 3700 DNA Analyzer. Sequencing data were compared with the updated Cambridge consensus human mitochondrial genome sequence (accession no. NC_012920) using DNASTAR version 5.01 (DNASTAR Inc.) (15 (link)).
6
Profiling Antigen-Specific B Cells
7
Cloning of ATP7B N-terminal in pGEX Vector
8
Genome-wide CRISPR Screening Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To prepare libraries for sequencing, 430 μg of extracted genomic DNA per sample were amplified and prepared for sequencing using Phusion Flash high-fidelity master mix (Thermo Fisher F548L) according to a previously described protocol (Chen et al. 2015 (link)). A two-step PCR reaction was employed to first amplify the sgRNA cassette and maintain library complexity (12 cycles), and a second PCR reaction was performed to add barcodes and Illumina adapters (16 cycles). Reactions were pooled after each PCR. Following the second PCR, reaction products were run on a 2.5% agarose gel and the DNA purified using a gel extraction kit (PureLink gel extraction kit; Invitrogen K210012). Once purified, the concentration of individual libraries was quantified using the Kapa Biosystems library quantification kit (Roche KK4824) according to kit instructions. Libraries were sequenced using an Illumina HiSeq 2500. The sequencing results were analyzed using the MAGeCK-VISPR pipeline (Li et al. 2015 (link)). For CRISPR score analyses of aligned and normalized read counts, the following formula was used: CRISPR score = log2 (final sgRNA abundance/initial sgRNA abundance) (Wang et al. 2015 (link)).
9
Cloning and Expression of GmmSRPN10
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding region for GmmSRPN10 was amplified from the G. m. morsitans midgut EST library clone [25] (link) using PCR (New England Biolabs, UK) according to the manufacturer's recommendations with primers having PmlI and SacI restriction enzyme overhangs (underlined).
Forward primer:TTTCACGTG ATGTCGGATTTAAATTTACAA ;
Reverse primer:TTTGAGCTC TTAAGCGTCTGGTGCGTTAAC .
Poly-A tailing was performed using reagents from the NEB PCR kit and ligated into a pGEM-T Easy holding vector (Promega). Holding vectors were transformed into E. coli XL-1 cells. Plasmid extraction from cultured XL-1 cells plus holding vector was performed using a miniprep kit (Qiagen). Extracted plasmids were subjected to Pmll and Sacl restriction enzyme (Promega) digest and the digestion products run on a 1% (w/v) agarose gel. The agarose gel bands corresponding to GmmSRPN10 coding region with cut restriction sites were excised from the gel and purified using the PureLink Gel Extraction Kit (Invitrogen). Gel purified bands were ligated into the pET-45b expression vector (Novagen), which allows for a His-tagged expression product. The expression construct was transformed into an E. coli Rosetta-gami (DE3)pLysS expression cell line (donated by Mark Paine, LSTM).
Forward primer:
Reverse primer:
Poly-A tailing was performed using reagents from the NEB PCR kit and ligated into a pGEM-T Easy holding vector (Promega). Holding vectors were transformed into E. coli XL-1 cells. Plasmid extraction from cultured XL-1 cells plus holding vector was performed using a miniprep kit (Qiagen). Extracted plasmids were subjected to Pmll and Sacl restriction enzyme (Promega) digest and the digestion products run on a 1% (w/v) agarose gel. The agarose gel bands corresponding to GmmSRPN10 coding region with cut restriction sites were excised from the gel and purified using the PureLink Gel Extraction Kit (Invitrogen). Gel purified bands were ligated into the pET-45b expression vector (Novagen), which allows for a His-tagged expression product. The expression construct was transformed into an E. coli Rosetta-gami (DE3)pLysS expression cell line (donated by Mark Paine, LSTM).
10
Single Genome Amplification for Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single genome amplification (SGA) was achieved using limiting dilutions in a nested PCR as described [82 (link)]. Briefly, cDNA was serially diluted and amplified to identify the dilution which would yield a PCR success rate of <30%; at such a dilution, most of the amplicons are generated from a single copy template. PCR was performed with 1x High Fidelity Platinum PCR buffer, 2mM MgSO4, 0.2 mM each dNTP, 0.2 uM each primer, and 0.1 units/uL High Fidelity Platinum Taq polymerase (Invitrogen) in a 20 uL reaction. Envelope amplicons were purified using either QiaQuick PCR purification kit (Qiagen) or Pure Link gel extraction kit (Invitrogen). These SGAs were reamplified by platinum-Taq Hi-Fi (Invitrogen) using gene specific primers. Amplification products were gel purified and cloned into the pEMC* expression vector using In-Fusion HD cloning (Takara). In-Fusion products were transformed into Stellar Competent Cells (ClonTech) and grown overnight on agar plates with ampicillin. Selected colonies were inoculated for DNA extraction by QIAPrep Spin Miniprep kit (Qiagen) and successful cloning was verified by Sanger sequencing (MGH CCIB DNA Core). Plasmid DNA from Sanger-verified preps was purified using the HiSpeed Plasmid Maxi Kit (Qiagen) or PowerPrep Plasmid Purification kit (Origene) and sequenced by Illumina.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!