Tie2 cre

Manufactured by Jackson ImmunoResearch

Sourced in United States, Montenegro

Tie2-Cre is a transgenic mouse line that expresses Cre recombinase under the control of the Tie2 promoter. The Tie2 gene encodes a receptor tyrosine kinase that is predominantly expressed in endothelial cells. This Tie2-Cre mouse line can be used to achieve conditional gene deletion or gene expression in the endothelial cell lineage.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Tie2-Cre mice (33 citations) Tie2-Cre transgenic mice (3 citations) Tie2-cre+/0(B6.Cg-Tg (Tek-cre)1Ywa/J) mice (2 citations)

45 protocols using tie2 cre

Conditional Exoc5 Knockout Mice Generation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Animals were kept in a 12-hour light-dark cycle with food and water ad libitum. The generation and genotyping of our Exoc5^f/f (aka Sec10) mice have been described previously^{13 (link)}. The conditional Exoc5 knockout mice were generated by crossing Exoc5^f/f with Nfatc1^Cre(+) (a kind gift from Dr. Bin Zhou) and Tie2^Cre(+) mice (Jackson Laboratories), and are designated as NfatC1^Cre(+);Exoc5^f/+, NfatC1^Cre(+);Exoc5^f/f, Tie2^Cre(+);Exoc5^f/+, and Tie2^Cre(+);Exoc5^f/f in the manuscript. Genotyping was performed by Transnetyx or inhouse with the KAPA Mouse Genotyping Kit (Kapabiosystems, #KK7301).

Fulmer D., Toomer K., Guo L., Moore K., Glover J., Moore R., Stairley R., Lobo G., Zuo X., Dang Y., Su Y., Fogelgren B., Gerard P., Chung D., Heydarpour M., Mukherjee R., Body S.C., Norris R.A, & Lipschutz J.H. (2019). Defects in the exocyst-cilia machinery cause bicuspid aortic valve disease and aortic stenosis. Circulation, 140(16), 1331-1341.

+ Open protocol

+ Expand

Snail1 Regulation of Vascular Development

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice were housed under standard condition and protocols approved by the University Committee on Use and Care of Animals (UCUCA). Mice carrying Snail1 alleles ^{17 (link)} and mice with Snail1-LacZ knock-in alleles ^{23 (link)} were generated and maintained in our laboratory. Tie2-Cre, Vav1-Cre, Dermo1-Cre and β-actin-GFP transgenic mice were obtained from Jackson Laboratory. VE-cadherin-Cre ERT2 transgenic mice were provided by ML Iruela-Arispe (University of California, Los Angeles) ^{66 (link)}. Littermate controls of both sexes were used in all experiments. All mouse strains were backcrossed into the C57BL/6J background for at least 7 generations. To inhibit Notch signaling in vivo, timed pregnant mice were injected subcutaneously with 100 mg/kg DAPT (Tocris Bioscience) dissolved in 10% ethanol and 90% corn oil at E7.5, E8.5 and E9.5 with the embryos dissected at E10.5 ^{6 (link)}. Gene inactivation in Snail1^LacZ/fl;VE-cadherin-Cre-ERT2⁺ embryos was triggered by i.p. injections of 150 μl of tamoxifen solution (10 mg/ml, dissolved in 1:10 ethanol/corn oil; Sigma) into pregnant females at E11.5 and E13.5. Gene inactivation in pups was triggered by i.p. injections of 50 μl tamoxifen solution (10 mg/ml) at p1 and p3. Eyes were retrieved from pups at p6 and fixed in 4% paraformaldehyde-PBS overnight at 4°C. Retinas were dissected and subjected to whole-mount PECAM-1.

Wu Z.Q., Rowe R.G., Lim K.C., Lin Y., Willis A., Tang Y., Li X.Y., Nor J.E., Maillard I, & Weiss S.J. (2014). A Snail1/Notch1 Signaling Axis Controls Embryonic Vascular Development. Nature communications, 5, 3998.

+ Open protocol

+ Expand

Genetically Modified Mouse Models for Investigating LRP5/6 Signaling

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lrp5^-/- [42 (link)] and Lrp5^a214v(neo)/+ [21 (link)] mice were generated as described. Lrp5^fl/fl and Lrp6^fl/fl [22 (link)], Flk1^Breier-Cre [30 (link)], Rx-Cre [23 (link)] and CD11b-Cre [29 (link)] mice were kindly provided by Drs. Bart O. William, Kevin P. Campbell, Eric Swindell and Roland Baron, respectively. VE-Cad-Cre [24 (link)], Tie2-Cre [25 (link)], LysM-Cre [28 (link)] and tdTomato [27 (link)] mice were purchased from the Jackson Laboratory. Flk1^Breier-Cre, Rx-Cre, CD11b-Cre, VE-Cad-Cre and Tie2-Cre mice were all transgenic lines generated by fusing the Cre gene to a fragment of the promoter sequence of Flk1, Rx, CD11b, VE-Cad and Tie2, respectively. LysM-Cre mice were knock-ins, generated by targeted insertion of the Cre cDNA into the endogenous M lysozyme locus. When animals from different genetic backgrounds were crossed, littermate controls were used to avoid confounding effects.

Huang W., Li Q., Amiry-Moghaddam M., Hokama M., Sardi S.H., Nagao M., Warman M.L, & Olsen B.R. (2016). Critical Endothelial Regulation by LRP5 during Retinal Vascular Development. PLoS ONE, 11(3), e0152833.

+ Open protocol

+ Expand

Mouse Genetic Models for Research

Cited 5 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Scf^gfp, Scf^fl, Scf ⁻, and Cxcl12^DsRed mice were described previously (Ding and Morrison, 2013 (link); Ding et al., 2012 (link)). Vav1-cre (de Boer et al., 2003 (link)), Albumin-cre (Weisend et al., 2009 (link)), Tie2-cre (Kisanuki et al., 2001 (link)), Pdgfrα-cre (Roesch et al., 2008 (link)), Ng2-cre (Zhu et al., 2008 (link)), and loxp-tdTomato (Madisen et al., 2010 (link)) mice were obtained from The Jackson Laboratory and maintained on C57BL/6 background. All mice were housed in a specific pathogen–free, Association for the Assessment and Accreditation of Laboratory Animal Care–approved unit at Columbia University Medical Center. All protocols were approved by Columbia University Committee on the Institute Animal Care and Use. Unless otherwise noted, data are mean ± SD, and two-tailed Student’s t tests were used to evaluate statistical significance (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001).

Lee Y., Leslie J., Yang Y, & Ding L. (2020). Hepatic stellate and endothelial cells maintain hematopoietic stem cells in the developing liver. The Journal of Experimental Medicine, 218(3), e20200882.

+ Open protocol

+ Expand

Endothelial BAMBI Knockout Mouse Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

All animal work was performed in compliance with Imperial College animal ethics guidelines according to the UK Home Office's Animals (Scientific Procedures) Act 1986. The Bambi^flox/flox and Bambi^−/− mice backcrossed on a C57BL/6 background (>10 generations) have been described previously.32, 34 To generate endothelial Bambi knock‐out mice, Tie2‐Cre [Jackson Laboratory no 008863 B6.Cg‐Tg(Tek‐cre)1Ywa/J] males were crossed with Bambi^flox/flox female mice. Bambi^flox/+Tie2‐Cre⁺ males were further bred with Bambi^flox/flox female mice to generate Bambi^flox/floxTie2‐Cre⁺ mice. Genotyping of Bambi^flox/flox and Bambi^−/− have been previously described.32, 34 For the detection of the Cre allele the following primers (FW: GCCTGCATTACCGGTCGATGCAACGA and R: GTGGCAGATGGCGCGGCAACACCATT) were used.

Crawley J.T., Zalli A., Monkman J.H., Petri A., Lane D.A., Ahnstrӧm J, & Salles‐Crawley I.I. (2019). Defective fibrin deposition and thrombus stability in Bambi −/− mice are mediated by elevated anticoagulant function. Journal of Thrombosis and Haemostasis, 17(11), 1935-1949.

+ Open protocol

+ Expand

Transgenic Mice for Cell-Specific TNAP Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transgenic mice expressing Cre-recombinase driven by the Tagln or Tie2 gene promoters (Tagln-Cre and Tie2-Cre respectively) were obtained from the The Jackson Laboratory (Bar Harbor, ME).
Tagln-Cre mice (aka SM22-Cre), express Cre recombinase driven by a smooth muscle cell-specific promoter. Strong expression of Cre in the vascular media was observed, but not in the endothelium during embryogenesis.^{(11 (link),14 (link),15 (link))} The Tie2-Cre mouse line expresses Cre recombinase driven by an endothelial cell (EC)-specific promoter/enhancer.^{(16 (link))}Hprt^ALPL knock-in mice were generated by GenOway (Lyon, France) using their proprietary “Quick Knock-in™” technology.^{(16 (link))}The crossbreeding of the Cre-expressing animals with the Hprt^ALPL mice results in excision of the stop cassette and transgene expression. Homozygous Tagln-Cre or heterozygous Tie2-Cre male mice were bred with homozygous female Hprt^ALPL mice to produce mice expressing TNAP in VSMCs or ECs respectively.^{(11 (link))}This work was conducted with approval of the Institutional Animal Care and Use Committees of Sanford Burnham Prebys Medical Discovery Institute, La Jolla, CA, for all animal studies.

Amadeu de Oliveira F., Narisawa S., Bottini M, & Millán J.L. (2020). Visualization of mineral-targeted alkaline phosphatase binding to sites of calcification in vivo. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 35(9), 1765-1771.

+ Open protocol

+ Expand

Tie2-Cre;Baf155 CKO Mice Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tie2-Cre;Baf155 CKO mice were obtained by first crossing Tie2-Cre (Stock No: 4128, Jackson Labs) males (2–3 months old) to Baf155^f/f (Choi et al., 2012 (link)) females (2–3 months old) to generate Tie2-cre; Baf155^f/+ mice. Next, timed matings using Tie2-Cre; Baf155^f/+ males (2–8 months old) and Baf155^f/f females (2–3 months old) were set up in the evening and females checked for vaginal plugs the following morning (12pm = E0.5). Females were separated from males and housed in the animal barrier until the desired time point. Females were euthanized using CO₂ asphyxiation and uteri removed for embryo collection. Embryos and collected tissue were kept on ice in PBS with 10% FBS until processed for analysis. Wild-type (WT) littermates were used as controls. Animal husbandry, generation, and handling were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee of Washington University School of Medicine in St. Louis.

Wu J., Krchma K., Lee H.J., Prabhakar S., Wang X., Zhao H., Xing X., Seong R.H., Fremont D.H., Artyomov M.N., Wang T, & Choi K. (2020). Requisite Chromatin Remodeling for Myeloid and Erythroid Lineage Differentiation from Erythromyeloid Progenitors. Cell reports, 33(7), 108395.

+ Open protocol

+ Expand

Generation and Characterization of Mouse Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Animal experiments were performed under protocols approved by the Boston Children's Hospital Animal Care and Use Committee (protocols 13-08-2460R and 13-12-2601). Ep300^fb mice were generated by homologous recombination in embryonic stem cells. Targeted ESCs were used to generate a mouse line, which was bred to homozygosity. This line has been donated to Jackson labs (Jax 025980). The Rosa26^fsBirA allele was derived from the previously described Rosa26^fsTRAP mouse (Zhou et al., 2013 (link)) (Jax 022367) by removal of the frt-TRAP-frt cassette using germline Flp recombination. The Rosa26^BirA (Driegen et al., 2005 (link)) (constitutive; Jackson Labs 010920), Tie2Cre (Kisanuki et al., 2001 (link)) (Jackson Labs 008863), Myf5Cre (Tallquist et al., 2000 (link)) (Jackson Labs 007893), EIIaCre (Williams-Simons and Westphal, 1999 (link)) (Jackson Labs 003724), Rosa26^mTmG (Muzumdar et al., 2007 (link)) (Jackson Labs 007576) and VEcad-CreERT2 (Sörensen et al., 2009 (link)) (Taconic 13073) lines were described previously.

Zhou P., Gu F., Zhang L., Akerberg B.N., Ma Q., Li K., He A., Lin Z., Stevens S.M., Zhou B, & Pu W.T. (2017). Mapping cell type-specific transcriptional enhancers using high affinity, lineage-specific Ep300 bioChIP-seq. eLife, 6, e22039.

+ Open protocol

+ Expand

Tracing En1-Lineage Fibroblasts in Dermis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mice were bred and maintained at the Stanford University Research Animal
Facility in accordance with Stanford University guidelines. All the animals were
housed in sterile micro-insulators and given water and rodent chow ad libitum.
En1^Cre, Wnt1^Cre,
Sox9^Cre,
Tie2^Cre, K5^Cre,
K14^Cre,
RAG-2^–/–,
FVB, R26^{tm1(HBEGF)Awai}, and
CAG-luc-eGFP L2G85 strains were obtained from Jackson
laboratories. The ROSA26^mTmG(R26^mTmG) reporter mice, which harbor a
double-fluorescent reporter that permanently replaces the expression of
membrane-bound tomato red fluorescent protein (RFP) with membrane-bound GFP
after recombination (10 (link)), were a gift
from L. Luo (Stanford University). En1^Cre transgenic
mice were crossed with R26^mTmG reporter mice (Fig. 1A).
En1^Cre;R26^mTmGoffspring were used to trace En1-lineage–positive
fibroblasts (EPFs), defined in vivo by their GFP positivity, into the dorsal
dermis.

Rinkevich Y., Walmsley G.G., Hu M.S., Maan Z.N., Newman A.M., Drukker M., Januszyk M., Krampitz G.W., Gurtner G.C., Lorenz H.P., Weissman I.L, & Longaker M.T. (2015). Identification and isolation of a dermal lineage with intrinsic fibrogenic potential. Science (New York, N.Y.), 348(6232), aaa2151.

+ Open protocol

+ Expand

Transgenic Mouse Lines for Cell-Specific Gene Targeting

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

C57BL/6J and MCH:ICR mice were purchased from CLEA Japan (Tokyo, Japan). Tie2-Cre [5 (link)], LysM-Cre [14 (link)], Pf4-Cre [15 (link)], and mT/mG mice [33 (link)] were obtained from the Jackson Laboratory (Bar Harbor, ME, USA). FLP66 transgenic mice (RBRC01252) [34 (link)] were obtained from RIKEN BRC (Tsukuba, Japan). The generation of Vegfr3-Cre transgenic lines, including the Vegfr3-Cre39 line used in this study, was described previously [25 (link)]. All mice were housed under pathogen-free conditions. All mouse work in this study was approved by the Animal Care and Use Committee of the University of Tokyo and was conducted in accordance with their guidelines (approval nos. 19–13, 19–14, PA11-94 and PA11-95).

Ichise H., Ichise T, & Yoshida N. (2016). Phospholipase Cγ2 Is Required for Luminal Expansion of the Epididymal Duct during Postnatal Development in Mice. PLoS ONE, 11(3), e0150521.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!