Phusion green hot start 2 high fidelity dna polymerase

Manufactured by Thermo Fisher Scientific

Sourced in United States

Phusion Green Hot Start II High-Fidelity DNA Polymerase is a thermostable DNA polymerase used for high-fidelity DNA amplification. It features a hot-start mechanism and a green dye for visualization during gel electrophoresis.

Automatically generated - may contain errors

Lab products found in correlation

12 protocols using phusion green hot start 2 high fidelity dna polymerase

Phusion Green PCR Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

All PCR amplifications were performed with Phusion Green Hot Start II High-Fidelity DNA
Polymerase (Thermo Fisher Scientific, Waltham, MA, U.S.A.) according to the manufacturer’s
instructions. Briefly, the PCR reactions were carried out using 30 ng of
genomic DNA in a final volume of 20 µl, containing 1 U Phusion DNA
polymerase, 0.2 mM dNTP, 0.5 nM gene-specific primers, and 3% volume DMSO under the
following conditions: denaturing at 98°C for 30 sec, 35 cycles at 98°C for 10 sec, 70°C
for 30 sec, 70°C for 30 sec per kilobase (kb), followed by an extended elongation at 72°C
for 10 min. The PCR products were analyzed by agarose gel electrophoresis. The amplicons
were purified using the innuPREP PCRpure kit (Analytik Jena AG, Jena, Germany), and then
sequenced at Fasmac Co., Ltd. (Atsugi, Japan). The sequences of primers used for
successful amplification of EBLs are listed in Table S1. The other primer sequences
(negative for PCR or sequencing primers) are available upon request. The determined
sequences were deposited in DDBJ (accession numbers LC378417-LC378424).

MUKAI Y., HORIE M, & TOMONAGA K. (2018). Systematic estimation of insertion dates of endogenous bornavirus-like elements in vesper bats. The Journal of Veterinary Medical Science, 80(8), 1356-1363.

+ Open protocol

+ Expand

Phusion Green Hot Start II PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The region was amplified using Phusion Green Hot Start II High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, Massachusetts, USA) with 0.6 μL of DMSO per sample following the manufacturer’s protocol at the Florida Museum of Natural History, University of Florida. The primers used were rpL32–F for forward and trnL^(UAG) for reverse [47 (link)]. The samples were incubated for an initial 45 s at 98°C and then 32 cycles of 10 s denaturation at 98°C, 30 s annealing at 55°C, and 40 s extension at 72°C. Finally, the samples were kept at 72°C for 5 min.

Shimai H., Setoguchi H., Roberts D.L, & Sun M. (2021). Biogeographical patterns and speciation of the genus Pinguicula (Lentibulariaceae) inferred by phylogenetic analyses. PLoS ONE, 16(6), e0252581.

+ Open protocol

+ Expand

Synthetic Influenza Virus Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Complete cDNAs of influenza virus genomic segments derived from sample MU-162 or of strain A/Brevig Mission/1/1918 (H1N1, BM) were commercially synthesized. Point mutations were introduced into BM segments with the Quikchange II Site-directed mutagenesis kit (Agilent, Santa Clara, CA, USA) according to manufacturer’s instructions. Coding sequences of polymerase and NP proteins were amplified by PCR with the Phusion Green Hot Start II High Fidelity DNA polymerase (ThermoFisher). PCR products for PB2, PA and NP were cloned into the BsaI sites of vector pCAGGS∆Bsa-Blue^{55 (link)}. PB1, which contains internal BsaI sites, was cloned into the BsmBI sites of a modified version of the pCAGGS plasmid. All constructs were confirmed by Sanger sequencing. Primers used for cloning and mutagenesis are listed in table S1.

Patrono L.V., Vrancken B., Budt M., Düx A., Lequime S., Boral S., Gilbert M.T., Gogarten J.F., Hoffmann L., Horst D., Merkel K., Morens D., Prepoint B., Schlotterbeck J., Schuenemann V.J., Suchard M.A., Taubenberger J.K., Tenkhoff L., Urban C., Widulin N., Winter E., Worobey M., Schnalke T., Wolff T., Lemey P, & Calvignac-Spencer S. (2022). Archival influenza virus genomes from Europe reveal genomic variability during the 1918 pandemic. Nature Communications, 13, 2314.

+ Open protocol

+ Expand

Quantitative Expression Analysis of DNA Repair Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were extracted with TRIzol reagent from cultured cells and treated with TURBO DNA-free kit. cDNAs were synthesized from 2 μg of total RNAs with High Capacity cDNA Reverse Transcription Kit (Life Technologies). Non-quantitative RT-PCR reactions were set up with Phusion Green Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA). qPCRs were set up with Fast SYBR Green Master Mix (Life Technologies) and run in StepOne Plus Real-Time PCR System (Life Technologies). The primer pairs for RT-PCR and qPCR were the same for each gene and they are BRCA1 prime pair 5′-ACTCTGAGGACAAAGCAGCG-3′ and 5′- CATCCCTGGTTCCTTGAGGG-3′, BRIP1 primer pair 5′- CGCTTTAGGAATAACCCAAGT-3′ and 5′- CTCATTGTCCTGTATATTGGTT-3′, RAD51 primer pair 5′- TTTGGCCCACAACCCATT TC-3′ and 5′- TTAGCTCCTTCTTTGGCGCA-3′, SRSF3 primer pair 5'-AATTGGAACGGGCTTTTGGC-3' and 5'-CCATCTAGCTCTCGGACTGC-3', and GAPDH primer pair 5′-GGGGCTGGCATTGCCCTCAA-3′ and 5′-GGCTGGTGGTCCAGGGGTCT-3′. The expression level of each gene was determined by the comparative CT (ΔΔCT) method [52 (link)] with GAPDH as the endogenous control and the subline A2780/LUCsi cells grown in the absence of Doxy as the reference. The primer pair for amplification of KMT2C cDNA between exon 44 and exon 46 was 5′-AGCACTGACACGTTTACCCA-3′ and 5′- AAGCCGGAGTGTTAGTGAGC-3′.

He X, & Zhang P. (2015). Serine/arginine-rich splicing factor 3 (SRSF3) regulates homologous recombination-mediated DNA repair. Molecular Cancer, 14, 158.

+ Open protocol

+ Expand

Experimental Validation of Computational RNA Editing

Check if the same lab product or an alternative is used in the 5 most similar protocols

To experimentally confirm our computational editing prediction, we chose seven hyper-edited regions and PCR-amplified genomic DNA and cDNA from a human brain from same donor (obtained from the NICHD Brain and Tissue Bank for Developmental Disorders at the University of Maryland, Baltimore, MD, USA). Primers were designed using Primer3 (ref. 65 (link)). The PCR reaction was performed in C1000 Thermal Cycler (Bio-Rad) using Phusion Green Hot Start II High-Fidelity DNA Polymerase (Thermo Scientific) and in a 20-μl reaction volume, according to the manufacturer’s instructions. We ran the following steps: 98 °C × 30 s, 35 cycles of (98 °C × 10 s, annealing Tm°C × 30 s (listed in Supplementary Table 5), and 72 °C × 30 s), and 7 min in 72 °C. PCR products were run on a 1% agarose gel, extracted using MinElute gel extraction kit (Qiagen), and sequenced in Hy Laboratories. Chromatograms of matched DNA and cDNA were aligned and editing sites were identified. Counts of observed editing sites in each region appear in Supplementary Table 5. Annotated chromatograms for two of the regions appear in Supplementary Fig. 3.

Porath H.T., Carmi S, & Levanon E.Y. (2014). A genome-wide map of hyper-edited RNA reveals numerous new sites. Nature Communications, 5, 4726.

+ Open protocol

+ Expand

RT-PCR Validation of Gene Fusion

Check if the same lab product or an alternative is used in the 5 most similar protocols

RT-PCR was performed on case #3 to validate the gene fusion and on one case (case #8) from the screening cohort. The primer sequences were designed based on the fusion junction read sequences from RNA sequencing (Supplementary Table 1). RNA after RNA sequencing was subjected to reverse transcription using SuperScript IV First-Strand Synthesis System (Invitrogen). PCR was performed by Phusion Green Hot Start II High-Fidelity DNA Polymerase (Thermo Scientific). The PCR products were then analyzed by gel electrophoresis and Sanger sequencing.

Kao Y.C., Lee J.C., Zhang L., Sung Y.S., Swanson D., Hsieh T.H., Liu Y.R., Agaram N.P., Huang H.Y., Dickson B.C, & Antonescu C.R. (2020). Recurrent YAP1 and KMT2A Gene Rearrangements in a Subset of MUC4-Negative Sclerosing Epithelioid Fibrosarcoma. The American journal of surgical pathology, 44(3), 368-377.

+ Open protocol

+ Expand

Cloning and Characterization of Dromedary Camel IFN-β Gene

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We identified potential IFNB gene coding region of the dromedary camel genome using homology BLAST. We designed PCR primers CdIFNb–NF & CdIFNb-NR (Table 1) at the flanking sequences of the putative protein-coding region of the IFNB. PCR amplification was performed using Phusion Green Hot Start II High-Fidelity DNA polymerase (Thermo Fisher Baltics, Vilnius, Lithuania) using genomic DNA as template from two camels. Independent amplicons were cloned into pGEM-T Easy vector (Promega, Madison, WI, USA) and sequenced as described previously (Premraj et al., 2020 (link)).Table 1

List of oligonucleotide primers used for IFN-β cloning or qPCR.

Table 1

Primer Name	Sequence - 5′ to 3′	Annealing Temperature	Product size	Remarks
CdIFNb–NF	GTGGTAGAACAGATCACTATTGC	58 °C	646 bp	Cloning of IFN-beta gene/cDNA
CdIFNb-NR	AGAACCTGACATCATTGTCAGCA	58 °C	646 bp	Cloning of IFN-beta gene/cDNA
CdIFNb-5RCFR	GTCCATCCTGTCCTTGAGGCAATACTG	65 °C	307 bp (5′RACE)	5′ RACE/Gene walking with SMARTer RACE/Universal Genome Walker Kits (Takara Bio)
CdIFNb-5RCNR	CAAGTTGCTGCTCCTTTGTTGGTACC	65 °C	307 bp (5′RACE)
CdIFNb-3RCFF	TCGATGTGCGGATAGACCATGTGG	65 °C	505 bp	3′RACE with SMARTer RACE kit (Takara Bio)
CdIFNb-qF	CCTGGCGGAAATAATGAAGGAG	60 °C	117 bp	Real-time qPCR
CdIFNb-qR	CAGCCGCTGTATTCCTTGGAC	60 °C	117 bp	Real-time qPCR

Premraj A., Aleyas A.G., Nautiyal B, & Rasool T.J. (2022). Beta interferons from the extant camelids: Unique among eutherian mammals. Developmental and Comparative Immunology, 133, 104443.

+ Open protocol

+ Expand

Cloning of Thermophilic Superoxide Dismutase Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNAs from Aeropyrum pernix K1 (taxonomy ID: 272557) and Saccharolobus solfataricus P2 (taxonomy ID: 273057) were isolated from frozen cells using the PureLink^® Genomic DNA Mini Kit (Invitrogen/Thermo Fisher Scientific, Waltham, MA, USA). The CDS of the two sod genes (locus sodF_AERPE and sodF_SACS2, respectively), encoding the Mn/Fe-dependent SOD (UniProtKB accessions Q9Y8H8 and P80857, respectively), were amplified by PCR. The amplification mix was as follows: 25 ng of genomic DNA as a template, 0.02 U/μL of Phusion Green HotStart II High-Fidelity DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA), 0.5 μM of each primer (Table S1A), and 200 μM of each dNTP. The PCR reactions were performed following the conditions already reported in Palmieri et al. [11 (link)]. The generated amplicons were confirmed by sequencing at Eurofins Genomics (Ebersberg, Germany). The 645 bp sod_Ap and 636 bp sod_Ss products were subcloned into the blunt end pSC-B-amp/kan vector using the StrataClone PCR Cloning Kit (Agilent Technologies, Santa Clara, CA, USA) and the sequence verification of the final constructs was carried out (Figure S1A,B).

Gogliettino M., Arciello S., Cillo F., Carluccio A.V., Palmieri G., Apone F., Ambrosio R.L., Anastasio A., Gratino L., Carola A, & Cocca E. (2022). Recombinant Expression of Archaeal Superoxide Dismutases in Plant Cell Cultures: A Sustainable Solution with Potential Application in the Food Industry. Antioxidants, 11(9), 1731.

+ Open protocol

+ Expand

Single-cell sorting and clonal analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three days post nucleofection, cells were stained with Fixable Viability Dye eFluor 780 (Invitrogen, cat. 65-0865-14) and single cell sorted using a FACSymphony S6 using FACSDiva software (version 9.5.1, BD Biosciences) into R10 (Jurkats) or activation medium (R10 + 50 U/mL IL-2, 0.1 μg/mL of anti-CD3 and -CD28 monoclonal antibodies) plus feeder cells (1×10⁶/mL NK and CD8+ T cell-depleted, 5000 rad irradiated allogeneic PBMCs). Three weeks after sorting, a small fraction of the cells was collected, genomic DNA extracted (QuickExtract^™ DNA Extraction Solution, Lucigen, cat. QE09050) and the remainder restimulated with fresh medium and cultured for an additional 14 days (Jones et al., 2016 (link)).
Clones were screened for integration with combinations of HDRT- and gene-specific primers, covering the entire construct and the integration sites (Table S2). PCRs were performed using Phusion Green Hot Start II High-Fidelity DNA Polymerase (ThermoFisher Scientific, cat. F537S) and Sanger sequencing of gel extracted amplicons performed (Azenta Life Sciences).

Teixeira A.R., Bittar C., Silva Santos G.S., Oliveira T.Y., Huang A.S., Linden N., Ferreira I.A., Murdza T., Muecksch F., Jones R.B., Caskey M., Jankovic M, & Nussenzweig M.C. (2024). Transcription of HIV-1 at sites of intact latent provirus integration. bioRxiv.

+ Open protocol

+ Expand

Phage Peptide Genome Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

As previously described by Pleiko et al. [52] , peptideencoding region of bacteriophage genome was amplified by PCR using Phusion Green Hot Start II High-Fidelity DNA Polymerase (#F537L, Thermo Scientific) in 25 μL reaction volume. Cycling conditions: denaturation at 98 °C for 30 s, followed by 25 amplification cycles (10 s at 98 °C, 21 s at 72 °C), and final elongation (72 °C for 5 min). Polymerase chain reaction (PCR) products were purified using AMPure XP Bead Based Next-Generation Sequencing Cleanup system (Beckmann Coulter, A63881) using 1.8 μL of beads per 1 μL of PCR products. Purified PCR products were quantified using Agilent Bioanalyzer 2100 Instrument using the High sensitivity DNA Kit (#5067-4626, Agilent). Ion Torrent Emulsion PCR and enrichment steps were performed using Ion PGM HiQ View OT2 kit (#A29900, Life Technologies). High throughput sequencing (HTS) was performed using Ion Torrent™ Personal Genome Machine™ (ION-PGM) using Ion PGM HiQ View sequencing kit (#A30044, Life Technologies) and Ion 316v2 chips (#448,149, Life Technologies). The FASTQ sequence files were converted to text files and translated using in-house developed python scripts.

Tobi A., Haugas M., Rabi K., Sethi J., Põšnograjeva K., Paiste P., Jagomäe T., Pleiko K., Lingasamy P, & Teesalu T. (2024). Protease-activated CendR peptides targeting tenascin-C: mitigating off-target tissue accumulation. Drug delivery and translational research.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!