Specific oligonucleotides

Quantitative RT-PCR (qRT-PCR) was performed as previously described (66 (link)). Total RNA from whole lungs was extracted using TRIzol (Invitrogen) from which cDNA was generated using the GRS cDNA Synthesis Mastermix (Grisp), following the manufacturer’s instructions. The resultant cDNA template was used to quantify the expression of target genes by qRT-PCR (CFX96 Real-Time System with C1000 Thermal Cycler, Bio-Rad) and normalized to ubiquitin mRNA levels using the ΔCt method. Target gene mRNA expression was quantified using SYBR Green (Thermo Fisher Scientific) and specific oligonucleotides (Invitrogen).

Total RNA was extracted using Triple XTractor (GB023.0100, Grisp, Porto, Portugal) according to the manufacturer’s instructions. cDNA was generated from 1 μg of RNA using the GRS cDNA Synthesis Master Mix (GK81.0100, Grisp) following the manufacturer’s instructions. The resultant cDNA template was used to quantify the expression of target genes by real-time PCR (Bio-Rad CFX96 Real-Time System with C1000 Thermal Cycler), and normalized to Ubiquitin mRNA levels using the ΔCt method (1.8^(Housekeeping gene mRNA expression—Target gene mRNA expression) × 100,000). Target gene mRNA expression was quantified using SYBR Green (Thermo Fisher Scientific, Waltham, MA, USA) and specific oligonucleotides (Invitrogen).

Two siRNAs targeting the human Prdx2 gene were designed: siPrdx2-1 (5′-GGAAGTACGTGGTCCTCTT-3′) and siPrdx2-2 (5′-GCCAGATCACTGTTAATGA-3′). The two siRNAs and a control siRNA were synthesized by Sangon Inc. (Shanghai, China). The siRNAs were transfected into HTR8 cells at a final concentration of 100 nmol/l using the Oligofectamine reagent (Invitrogen, Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol. Knockdown of c-Myc was performed using specific oligonucleotides purchased from Santa Cruz Biotechnology Inc. (TX, USA), which were transfected into cells using the Oligofectamine reagent (Invitrogen). All cells were cultured for 48 h after transfection before they were harvested for quantitative RT-PCR, western blot and other analyses. To create the c-Myc overexpression construct, the coding region sequence of human c-Myc was cloned into the pEX-2 vector (GenePharma, Shanghai, China). The c-Myc-pEX-2 vector and control vector were purified using the PureYield Plasmid Miniprep System (Promega, Madison, WI, USA), and transfected into the cells using Lipofactamine 3000 (Invitrogen) according to the manufacturer’s protocol. All cells were cultured for 48 h after transfection before other assays were performed.

Thyroid and hypothalamic total RNAs were extracted using the RNeasy Plus Mini Kit (Qiagen) following the manufacturer's instructions. After DNase treatment, RT was carried out followed by real-time PCR as described previously (Schmittgen et al. 2008 (link)). Specific oligonucleotides, as described in Supplementary Table 1, see section on supplementary data given at the end of this article, were purchased from Applied Biosystems. For each gene tested, the amplification of different cDNA quantities was linear in the PCR assay conditions used. In this experiment, β-actin was used as an internal control, and the results are expressed as ΔΔCT.

Total RNA was extracted from the heart using the RNeasy Fibrous Tissue Mini Kit (Qiagen, Valencia, California), and RNeasy Plus Mini Kit (Qiagen, Valencia, California) was used for liver and kidney tissues, following the manufacturer's instructions. After DNAse treatment, reverse transcription was followed by real-time polymerase chain reaction (PCR), as previously described (16). GAPDH was used as an internal control. The specific oligonucleotides listed in Table 1, were purchased from Applied Biosystems (Foster City, California).

RNeasy® Fibrous Tissue Mini Kit (Qiagen, Valencia, CA, USA) was used to extract the total RNA from heart tissues. Real-time PCR was used after DNAse treatment and reverse transcription, as described previously [25 (link)]. The internal control used was glyceraldehyde 3-phosphate dehydrogenase. The specific oligonucleotides were obtained from Applied Biosystems (Foster City, CA, USA). The pairs of primers used for RT-PCR were as follows: NOX2: forward: AACTGGCTGTACTGCTTG, reverse: CGAGTCACAGCCACATACAG; NOX4: forward: TCCATCAAGCCAAGATTCTGAG, reverse: GGTTTCCAGTCATCCAGTAGAG; GAPDH: forward: TGATTCTACCCACGGCAAGT, reverse: AGCATCACCCCATTTGATGT.