Thermo fisher connect

Manufactured by Thermo Fisher Scientific

Sourced in United States

Thermo Fisher Connect is a cloud-based platform that enables secure data management and remote monitoring for Thermo Fisher Scientific laboratory equipment. The platform provides a centralized interface for users to access, analyze, and share data from connected instruments.

Automatically generated - may contain errors

Lab products found in correlation

7 protocols using thermo fisher connect

Quantitative VAMP2 Gene Expression in PBMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood mononuclear cells (PBMCs) were isolated by density gradient (Lympholyte-H, Cedarlane, Canada). Total RNA was extracted from PBMCs using the Chomczynski and Sacchi’s modified method (Chomczynski and Sacchi, 2006 (link)). Two micrograms of total RNA were reverse-transcribed using the SuperScript VILOTM cDNA Synthesis Kit (Invitrogen by Thermo Fisher Scientific, Massachusetts, United States). Quantitative PCRs were performed in the OpenArray^® system QuantStudio 12K Flex Real-Time PCR System (Applied Biosystems by Thermo Fisher Scientific, Massachusetts, United States). For the VAMP2 gene expression analysis, qPCR reactions based on TaqMan probes Hs00360269_m1 (Thermo Fisher Scientific) were performed using high-performance OpenArray^® chip. Three genes have been selected as endogenous according to their stable expression in human cells (GAPDH, ACTB and 18S) and included into the OpenArray^® chip. One hundred and twenty ng of every cDNA sample (1.2 μL of each) were mixed with 1.3 μL of PCR-grade water and 2.5 μL of TaqMan™ OpenArray^® Real-Time PCR Master Mix (Applied Biosystems by Thermo Fisher Scientific, Massachusetts, United States). Samples were loaded in duplicate into Open-Array^® plates. For gene expression analysis, Ct values were obtained using the Thermo Fisher ConnectTM (Thermofisher) online application, and the Relative Quantification (RQ) software.

Costa A.S., Ferri E., Guerini F.R., Rossi P.D., Arosio B, & Clerici M. (2022). VAMP2 Expression and Genotype Are Possible Discriminators in Different Forms of Dementia. Frontiers in Aging Neuroscience, 14, 858162.

+ Open protocol

+ Expand

Evaluating Antibiotic Resistance in Mtb

Check if the same lab product or an alternative is used in the 5 most similar protocols

A mid log phase Mtb H37Rv culture was incubated overnight in Middlebrook 7H9 broth (supplemented with + 10 % OADC + 0.05% Tween80 + 0.4% glycérol) with subinhibitory concentrations of clarithromycin or SEQ-9 (0.125μg/ml and 0.25μg/ml). MICs were then determined for each culture using a microplate Alamar blue assay as described above. For RNA extraction, cells were lysed in Thioglycerol with fast prep instrument (MP Biomedicals) and total RNA was extracted using MaxWell RSC Instrument with the Maxwell RSC simply RNA Cells kit (Promega) according to the manufacturer’s protocol. RNA concentration was measured with nanodrop (Thermo Scientific) and RNA quality was evaluated by Bioanalyzer (Agilent). Reverse transcription of total mRNA was performed with 500 ng total RNA using SuperScript™ IV VILO (Applied Biosystems) and quantified using 7500 Real-Time PCR system (Applied Biosystems) The data was analyzed using ThermoFisher ConnectTM online application (ThermoFisher). The mRNA content was normalized to 23S expression. GraphPad Prism 8 was used for statistical analysis using Student’s t-test (dCT). Probes used for mRNA detection were erm37 (F: AGCGATTCCCTGGCATTACC; R: GCGGGTTCGCCACAAC; FAM, ACGCCGCCTCGATCC); for 23S (F: GCGCCCGTGACGAATC, R: ACGCAGCCCCAGAACTC, FAM: TAACCACCCAAAACCG).

Zhang J., Lair C., Roubert C., Amaning K., Barrio M.B., Benedetti Y., Cui Z., Xing Z., Li X., Franzblau S.G., Baurin N., Bordon-Pallier F., Cantalloube C., Sans S., Silve S., Blanc I., Fraisse L., Rak A., Jenner L.B., Yusupova G., Yusupov M., Zhang J., Kaneko T., Yang T.J., Fotouhi N., Nuermberger E., Tyagi S., Betoudji F., Upton A., Sacchettini J.C, & Lagrange S. (2023). Discovery of natural-product-derived sequanamycins as potent oral anti-tuberculosis agents. Cell, 186(5), 1013-1025.e24.

+ Open protocol

+ Expand

Quantifying Gene Expression by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene expression was quantified by quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) as previously described [34 (link)]. In brief, liver RNA was extracted using TRI reagent (Sigma-Aldrich, St. Louis, MO) and quantified using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). cDNA was synthesized with the RT² HT First Strand Kit (Qiagen, Germany). After which, qRT-PCR was performed by using cDNA, custom primers (Integrated DNA Technologies, Coralville, Iowa) and SYBR® Green SuperMix (Quantabio, Beverly, MA) on a QuantStudio 12K Flex Real-Time PCR System according to the manufacturer’s protocol (Thermo Fisher Scientific, Waltham, MA). Relative quantification of PCR products was accomplished using Thermo Fisher Connect™ (Thermo Fisher Scientific, Waltham, MA). Hepatic expression of genes involved in lipolysis, cholesterol synthesis and uptake and mitochondrial biogenesis were quantified relative to the expression of glyceraldehyde 3-phosphate dehydrogenase (Gapdh) using a comparative method (2^−ΔΔCT). Primer sequences are available in Table S2.

Khoo W.Y., Chrisfield B.J., Sae-tan S, & Lambert J.D. (2019). Mitigation of non-alcoholic fatty liver disease in high fat-fed mice by the combination of decaffeinated green tea extract and voluntary exercise. The Journal of nutritional biochemistry, 76, 108262.

+ Open protocol

+ Expand

Cytokine and Chemokine Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We examined the Il-23, Il-1β, Ccl2, Ccl3, Ccl4, Inos, and Gapdh expression in differentiated- (1 × 10⁷ cells) and undifferentiated-MPRO clone 2.1 cells (2 × 10⁷ cells). Both differentiated- and undifferentiated-MPRO clone 2.1 cells were treated with the supernatants of Cl66, Cl66-Dox, Cl66-Pac, and SF media cells for 24 h. Details of RNA isolation and reverse transcription are described in [54 (link)]. We prepared qRT-PCR reactions using PowerUp™ SYBR™ Green Master Mix (Thermo Fisher, Carlsbad, CA, USA), cDNA, gene-specific primers, and nuclease-free water. The results were analyzed using Thermo Fisher Connect (Thermo Fisher, Carlsbad, CA, USA). Mean Ct values of the target genes were normalized to mean Ct values of the endogenous control, Gapdh; [−∆Ct = Ct (GAPDH) − Ct (target gene)]. We calculated the ratio of mRNA expression of target genes versus Gapdh (2^(−∆Ct) and further normalized it with the control (MPRO cells in SF) (2^{(−∆∆Ct)}). Melting curve analysis was performed to check the specificity of the amplified products. The details of the sequence of gene-specific primers are in Table 1.

Wu L., Saxena S., Goel P., Prajapati D.R., Wang C, & Singh R.K. (2020). Breast Cancer Cell–Neutrophil Interactions Enhance Neutrophil Survival and Pro-Tumorigenic Activities. Cancers, 12(10), 2884.

+ Open protocol

+ Expand

qRT-PCR Analysis of Plexin-B3, BCL-2, and ALDH1-A1 Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We plated T3M-4- and CD18/HPAF-shPlexin-B3 and their respective control cells at 6 × 10⁶ in a 100-mm dish for mRNA analysis. We performed RNA isolation and cDNA preparation as described previously [22 (link)]. We prepared quantitative Real Time-Polymerase Chain Reactions (qRT-PCR) using PowerUp™ SYBR™ Green Master Mix (Thermo Fisher, Carlsbad, CA, USA), complementary DNA, gene-specific primers, and nuclease-free water. The results were analyzed using Thermo Fisher Connect (Thermo Fisher). Mean C_t values of the target genes were normalized to mean C_t values of the endogenous control, hypoxanthine-guanine phosphoribosyltransferase (HPRT) (−∆C_t = C_t (HPRT) − C_t (target gene)). We calculated the mRNA expression of target genes versus HPRT (2^(−∆Ct)), analyzed the melting curve, and used 1% agarose gels to resolve the amplified product. The details of the primers are PLXNB3- Fwd (forward): AGGGCGAGAGGACCATCTAC, Rev (reverse): GCCTCGGAAATGTTGAAGGTT, BCL-2- Fwd: TCCATGTCTTTGGACAACCA, Rev: CTC CACCAGTGTTCCCATCT, ALDH1-A1- Fwd: CCATAACAATCTCCTCTGCTC, Rev: CTCCCAGTTCTCTTCCATTTC, HPRT- Fwd: AGGGTGTTTATTCCTCATGGAC, and Rev: GTAATCCAGCAGGTCAGCAAAG.

Saxena S., Prajapati D.R., Goel P., Tomar B., Hayashi Y., Atri P., Rachagani S., Grandgenett P.M., Hollingsworth M.A., Batra S.K, & Singh R.K. (2021). Plexin-B3 Regulates Cellular Motility, Invasiveness, and Metastasis in Pancreatic Cancer. Cancers, 13(4), 818.

+ Open protocol

+ Expand

Quantifying COX-1 and COX-2 Expression in CRC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the RNeasy Micro kit (QIAGEN, UK). and then treated with DNase I (New England Biolabs, UK). cDNA synthesis was performed with 1 μg of total RNA input using the Omniscript RT kit (QIAGEN, UK). Real-time PCR was performed using GoTaq qPCR mastermix (Promega, UK) and the following primers, PTGS1: forward 5′-GAGCAGCTTTTCCAGACGA-3′ and reverse 5′-TCCTCGATGACAATCTTGATG-3′, PTGS2: forward 5′-CCCTTGGGTGTCAAAGGTAA-3′, reverse 5′-GCCCTCGCTTATGATCTGTC-3′ and GAPDH: forward 5′-TCAACGACCACTTTGTCAAGC-3′ and reverse 5′-CCAGGGGTCTTACTCCTTGG-3′. Relative quantification using ThermoFisher Connect™ generated a gene expression score for COX-1 and COX-2 according to the respective ∆Ct value [Ct_(PTGS) − Ct_(GAPDH)] tertile [zero for no expression (as defined by the absence of a Ct_(PTGS) value below that associated with background), or 1–3]. The overall COX score for each cell line was determined by summing COX-1 and COX-2 scores. Data are expressed as the mean ± SEM of three biological replicates for each human CRC cell line.

Volpato M., Ingram N., Perry S.L., Spencer J., Race A.D., Marshall C., Hutchinson J.M., Nicolaou A., Loadman P.M., Coletta P.L, & Hull M.A. (2020). Cyclooxygenase activity mediates colorectal cancer cell resistance to the omega-3 polyunsaturated fatty acid eicosapentaenoic acid. Cancer Chemotherapy and Pharmacology, 87(2), 173-184.

+ Open protocol

+ Expand

Profiling miRNA Expression in Cellular Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

The miRNA milieu of treated and endogenous control cells was assessed using Taqman ® Advanced miRNA (miR) Open Arrays on the Thermo Fisher 12K OpenArray Flex platform (Thermo Fisher, Waltham, MA USA). These arrays contain unique probes to 754 miR targets (plate IDs available from Thermo Fisher, Advanced microRNA panel, Waltham, MA, USA). Data were analysed using Thermo Fisher 'Connect You' lab software (Thermo Fisher Connect™, Thermo Fisher, Waltham, MA USA, (https://www.thermofisher.com). Target microRNAs demonstrating the largest fold changes across the treatments were selected for follow up (supplementary table S1 andS2).

Jeffery N, & Harries L.W. (2019). miRNAs responsive to the diabetic microenvironment in the human beta cell line EndoC-βH1 may target genes in the FOXO, HIPPO and Lysine degradation pathways. Experimental cell research, 384(1).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!