After 24 h of coculturing with different exosomes (NO-exo, H/R-exo, N-exo, and PE-exo), 5 μg total RNA was extracted from treated HUVECs using an RNA extraction kit. Reverse transcription was performed using a reverse transcription kit. A StepOnePlus real-time quantitative PCR system (Invitrogen, CA, USA) was used to measure mRNA in HUVECs. The VE-cadherin primers (5′-ACGACAACTGGCCTGTGTTCAC and 3′-TG-CATCCACTGCTGTCACAGAG) yielded a 101-base pair fragment. The Occludin primers (5′-ACCCCCATCTGACTAT-GTGGAA and 3′-AGGAACCGGCGTGGATTTA) yielded a 115-base pair fragment. The GAPDH primers (5′-AGATCCCTCCAAAATCAAGTGG and 3′-GGCAGAGA TGATGACCCTTTT) yielded a 130-base pair fragment. SYBR® Premix Ex Taq™ (Accurate Biotechnology, Hunan, China) was used for amplification, and gene expression was calculated with the 2–ΔΔCT method (with GAPDH as an internal reference).
Sybr premix ex taq
Manufactured by Accurate Biology
Sourced in China
SYBR Premix Ex Taq is a ready-to-use solution for real-time PCR amplification. It contains SYBR Green I dye, Taq DNA polymerase, dNTPs, and reaction buffer components.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (4 mentions)
Primescript rt reagent kit with gdna eraser, by Accurate Biology (2 mentions)
Primescript rt reagent kit, by Accurate Biology (2 mentions)
Primescript rt kit, by Accurate Biology (2 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Trizol method, by Thermo Fisher Scientific (1 mentions)
Primescript rt kit with gdna eraser, by Takara Bio (1 mentions)
Puerarin, by Merck Group (1 mentions)
Cleaved caspase 1, by Abcam (1 mentions)
Il 18, by Abcam (1 mentions)
Il 1β, by Abcam (1 mentions)
Caspase 1 activity assay kit, by Beyotime (1 mentions)
Streptozotocin (stz), by Merck Group (1 mentions)
Gapdh, by Abcam (1 mentions)
Ldh assay kit, by Beyotime (1 mentions)
Bcl 2, by Abcam (1 mentions)
Bcl2 associated x (bax), by Abcam (1 mentions)
Cck 8 assay kit, by Beyotime (1 mentions)
Caspase 1, by Abcam (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
9 protocols using sybr premix ex taq
1
Exosome-Mediated Regulation of Endothelial Cell Gene Expression
2
miR-22-3p Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The primer sequences were synthetized by RIBOBIO Corporation (Guangzhou, China). Trizol (Thermo Fisher Scientific Inc., MA, USA) method was employed to extract the total RNA in the cells in each group, and the concentration and purity of the RNA were measured. Samples were reacted in an Eppendorf PCR amplifier and the PCR amplification was conducted by SYBR® Premix Ex Taq (Accurate Biotechnology Co., Ltd. Hunan, China) and a real-time quantitative PCR amplifier (Applied Biosystems QuantStudio 5, ABI Company, Oyster Bay, NY), according to the directions of PrimeScript RT reagent Kit with gDNA Eraser (Accurate Biotechnology Co., Ltd. Hunan, China). U6 (F: 5′-CGCTTCGGCAGCACATATAC-3′; R: 5′-TTCACGAATTTGCGTGTCAT-3′) was, respectively, used as the internal reference of miR-22-3p. The data were analyzed by 2−ΔΔCT method.
3
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The primer sequences (Table 1 ) were synthesized by RIBOBIO (Guangzhou, China). Total RNA from different cell groups was extracted using the TRIzol method (Thermo Fisher Scientific Inc.), and its concentration and purity were measured. The samples were then subjected to PCR amplification using the Eppendorf PCR machine and SYBR® Premix Ex Taq (Accurate Biotechnology Co., Ltd.) for PCR amplification. Real-time quantitative PCR was performed using the Applied Biosystems QuantStudio 5 PCR machine (ABI, Oyster Bay, NY), according to the instructions of the PrimeScript RT Kit with gDNA Eraser (Takara Bio, China, Hunan). The data were analyzed using the 2−ΔΔCT method.
Primers and their sequences used in quantitative real-time PCR
| Gene | Primer-F (5'-3') | Primer-R (5'-3') |
|---|---|---|
| β-actin | AACAGTCCGCCTAGAAGCAC | CGTTGACATCCGTAAAGACC |
| BAX | CAGGATGCGTCCACCAAGAA | CGTGTCCACGTCAGCAATCA |
| BCL2 | TATGATAACCGGGAGATCGTGATC | GTGCAGATGCCGGTTCAGGTACTC |
| GluR2 | GCTGGTGGCTTTGATT GAGT | TCTGCGAGGAAGATGGGTTA |
4
Quantitative Real-Time PCR of ZCCHC Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The quantitative real-time PCR (qRT-PCR) analysis was performed to verify the expression patterns of ZCCHC genes revealed in the microarray analysis. The primer sequences were synthesized by Tsingke Biotechnology Co., Ltd., Qingdao, China (Table S1 ). Trizol (Thermo Fisher Scientific Inc., MA, USA) method was employed to extract the total RNA from cells in each group according to the manufacturer’s protocol. The total RNA (1 µg) was reverse-transcribed to cDNA by use of PrimeScript RT Reagent Kit with gDNA Eraser (Accurate Biotechnology Co., Ltd., Hunan, China). All genes involved in the experiment were examined by a quantitative real-time PCR amplifier (Applied Biosystems QuantStudio 5, ABI Company, Oyster Bay, New York, USA) with SYBR® Premix Ex Taq (Accurate Biotechnology Co., Ltd., Hunan, China). PCR procedure: pre-denaturation at 95 °C for 30 s, 40 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, and finally melting at 95 °C for 30 s.
5
Puerarin Attenuates Diabetic Complications
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Puerarin (purity ≥98%), streptozotocin (STZ, purity ≥98%) and CoCI2 were obtained from Sigma Aldrich (MO, USA). CCK8 assay kit, LDH assay kit, ELISA Kits and Caspase‐1 activity assay kit was purchased from Beyotime (China). Annexin V Alexa Fluor 488‐PI was obtained from ThermoFisher (MA, USA). DCFDA probes were purchased from Yesen (Shanghai, China). Polyclonal antibodies against eNOS, p‐eNOS, NLRP3, GSDMA, Cleaved Caspase‐1, Caspase‐1, IL‐1β, IL‐18, Bax, Bcl‐2, CD31 and GAPDH were purchased from Abcam (MA, USA). PrimeScript® RT reagent Kit and SYBR® Premix Ex Taq™ were purchased from ACCURATE BIOLOGY (China).
6
Quantification of Immune Checkpoint Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen) was used to extract total RNA from cells. After total RNA was quantified using spectrophotometry, reverse transcription was performed using the PrimeScript RT kit (Accurate Biology, Hunan, China). Real-time PCR was performed using SYBR Premix Ex Taq (Accurate Biology, Hunan, China) and a 7900HT fast real-time PCR system (Applied Biosystems, Waltham, MA, USA). The primer sequences for the TIGIT, PD-1, LAG3, Tim3 and β-actin genes are shown in the Additional file 1 : Table S1. The mRNA level of a specific gene was normalized to β-actin.
7
Quantifying Synovial Fibroblast Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of the synovial fibroblasts was isolated using a RNA Purification Kit (EZBioscience, United States) and transcribed into cDNA with a PrimeScript RT reagent kit (Accurate Biology, China). RT-qPCR analyses were then performed using a LightCycler 480 RealTime PCR System (Roche, Basel, Switzerland) with a SYBR Premix Ex Taq (Accurate Biology, China). The results were normalized to the expression level of GAPDH and the relative expression of each gene was determined with the 2^(−ΔΔCt) method. The forward and reverse primers for each gene are listed in Table 2 .
8
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two candidate genes' expression levels in CDMA66 and Huangzao4 were further analyzed using qRT-PCR at time points of 12, 24, 48, and 72 h after inoculation. Total RNA was extracted using an RNAiso kit (TaKaRa, Japan) according to the manufacturer's instructions. Single-strand cDNA was synthesized with a reverse transcription kit (TaKaRa, Japan).
Quantitative RT-PCR assays were performed with SYBR Premix Ex Taq (Accurate Biology, China) on a T100 TM Thermal Cycler (BIO-RAD). The primers used for qRT-PCR are listed in Supplementary Table 2. The temperature cycling conditions were 94 • C for 30 s, then 40 cycles of 95 • C for 10 s and 55 • C for 10 s and 72 • C for 30 s. With Actin1 as an inference gene, the relative expression of interest genes was determined using the 2 -Ct method (Zhang et al., 2017) (link). The qRT-PCR experiment was independently repeated at least twice, with each sample run in triplicate, and a representative data set was shown.
Quantitative RT-PCR assays were performed with SYBR Premix Ex Taq (Accurate Biology, China) on a T100 TM Thermal Cycler (BIO-RAD). The primers used for qRT-PCR are listed in Supplementary Table 2. The temperature cycling conditions were 94 • C for 30 s, then 40 cycles of 95 • C for 10 s and 55 • C for 10 s and 72 • C for 30 s. With Actin1 as an inference gene, the relative expression of interest genes was determined using the 2 -Ct method (Zhang et al., 2017) (link). The qRT-PCR experiment was independently repeated at least twice, with each sample run in triplicate, and a representative data set was shown.
9
Fluorescence Immunohistochemistry and qRT-PCR Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For immuno uorescence analysis, we use multiple uorescence immunohistochemical staining kits (Absin, Shanghai, China). Heat-mediated antigen retrieval and primary antibody incubation are the same as immunohistochemistry. After incubating the secondary antibody for 10 minutes, incubate the slides with the uorescent staining ampli cation solution for 10 minutes at 37°C. After washing three times with TBST, incubate the slides with 4′,6-diamidino-2-phenylindole (DAPI) for 5 minutes. Finally, an antiuorescence quenching agent was used to seal the slides.
Real-time Quantitative Rt-pcr (Qrt-pcr)
Trizol reagent (Invitrogen) was used to extract total RNA from cells. After total RNA was quanti ed by spectrophotometry, reverse transcription was performed using the PrimeScript RT kit (Accurate biology, Hunan, China). Real-time PCR was performed using SYBR Premix Ex Taq (Accurate biology, Hunan, China) and 7900HT fast real-time PCR system (Applied Biosystems, Waltham, MA, USA). The primer sequences of genes including TIGIT, PD-1, LAG3, Tim3 and β-actin are shown in the supplementary information. The mRNA level of a speci c gene were normalized with β-actin.
Real-time Quantitative Rt-pcr (Qrt-pcr)
Trizol reagent (Invitrogen) was used to extract total RNA from cells. After total RNA was quanti ed by spectrophotometry, reverse transcription was performed using the PrimeScript RT kit (Accurate biology, Hunan, China). Real-time PCR was performed using SYBR Premix Ex Taq (Accurate biology, Hunan, China) and 7900HT fast real-time PCR system (Applied Biosystems, Waltham, MA, USA). The primer sequences of genes including TIGIT, PD-1, LAG3, Tim3 and β-actin are shown in the supplementary information. The mRNA level of a speci c gene were normalized with β-actin.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!