For immunofluorescence staining, images were acquired on a Leica DM5500B microscope with attached Hamamatsu C10600-10B camera and analyzed with a MetaMorph (version 7.7; MDS Analytical Technologies) software. For quantification of immunoblotting, exposed films were scanned by an HP scanner and quantified by the ImageJ software.
Dm5500b microscope
Manufactured by Hamamatsu Photonics
Sourced in United States
The DM5500B is a microscope designed and manufactured by Hamamatsu Photonics. It is a powerful imaging tool that utilizes advanced optical and electronic components to provide high-quality images. The DM5500B is capable of delivering detailed visual information, though its specific intended use is not included in this factual description.
Automatically generated - may contain errors
Lab products found in correlation
Orca flash4.0 camera, by Leica (5 mentions)
Las x software v2, by Leica (4 mentions)
Las v4.4 system software, by Leica (1 mentions)
Lasaf v2, by Leica (1 mentions)
Tcs sp5 2, by Leica (1 mentions)
Nanozoomer s60 digital slide scanner, by Hamamatsu Photonics (1 mentions)
Superscript 3 first strand synthesis kit, by Thermo Fisher Scientific (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (1 mentions)
Lasx software package, by Leica (1 mentions)
Dm5500b microscope, by Leica (1 mentions)
Tetramethylrhodamine 5 dutp, by Merck Group (1 mentions)
Dig nick translation mix, by Merck Group (1 mentions)
Las x software v, by Leica (1 mentions)
9 protocols using dm5500b microscope
1
Immunofluorescence and Immunoblotting Imaging
2
Meiotic Metaphase I Nuclei Imaging
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Meiotic metaphase I nuclei stained with acetocarmine or Feulgen were imaged using a Leica DM2000 microscope equipped with a Leica DFC450 camera and controlled by LAS v4.4 system software (Leica Biosystems, Wetzlar, Germany). Images were processed using Adobe Photoshop CS5 (Adobe Systems Incorporated, USa) extended version 12.0 × 64.
Meiotic metaphase I nuclei labelled by GISH were imaged using a Leica DM5500B microscope equipped with a Hamamatsu ORCA-FLASH4.0 camera and controlled by Leica LAS X software v2.0. Images were processed using Fiji (an implementation of ImageJ, a public domain program by W. Rasband available fromhttp://rsb.info.nih.gov/ij/ ).
Polyacrylamide-embedded meiocytes were optically sectioned using a Leica TCS SP5II confocal laser scanning microscope (CLSM) controlled by Leica LAS-AF v.2.7 software. Z-stacks were deconvolved using Huygens Essential (Scientific Volume Imaging BV). Projections and analysis of 3D pictures were performed using Fiji.
Meiotic metaphase I nuclei labelled by GISH were imaged using a Leica DM5500B microscope equipped with a Hamamatsu ORCA-FLASH4.0 camera and controlled by Leica LAS X software v2.0. Images were processed using Fiji (an implementation of ImageJ, a public domain program by W. Rasband available from
Polyacrylamide-embedded meiocytes were optically sectioned using a Leica TCS SP5II confocal laser scanning microscope (CLSM) controlled by Leica LAS-AF v.2.7 software. Z-stacks were deconvolved using Huygens Essential (Scientific Volume Imaging BV). Projections and analysis of 3D pictures were performed using Fiji.
3
In Situ Hybridization of Zebrafish and Xenopus Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers were designed for zebrafish col10a1a Fw CCTGGAGCCAAAGGAGAGTT; Rev TATCGGCAGCAAAGACACCA; and zebrafish col10a1b Fw TTCATCTCCTGGGAAGCCTG; Rev TTCACCTCTGCTACCTGGTG gene sequences. Zebrafish cDNA was synthesized with SuperScript III First-Strand Synthesis Kit (ThermoFisher) and oligo dT primers using RNA isolated from zebrafish embryos at 5 days post fertilization (dpf) as a template. Fragments were PCR amplified and cloned from zebrafish cDNA into TOPO pCR II TOPO vector and antisense RNA probes were synthesized with either SP6 or T7 RNA polymerase and digoxigenin labeling mix (Roche). In situ hybridization on zebrafish whole-mount larvae was done as previously described (Filipek-Górniok et al. 2013 (link)). Whole-mount larvae after in situ were embedded in paraffin and sectioned at 6 µm. Sections were imaged with 40× objective on Leica DM5500B microscope and Hamamatsu NanoZoomer S60 Digital Slide Scanner.
In situ hybridization on paraffin sections of X. tropicalis stage NF60 tadpoles were performed using previously reported Col10a1 probe and previously described protocol (Aldea et al. 2013 (link)).
In situ hybridization on paraffin sections of X. tropicalis stage NF60 tadpoles were performed using previously reported Col10a1 probe and previously described protocol (Aldea et al. 2013 (link)).
4
Immunofluorescence Profiling of RNA-Binding Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For immunofluorescence, cells were fixed in 10% neutral formalin and incubated overnight with the primary antibodies68 (link): anti-Sfpq, anti-Pspc1, or anti-Ago2 antibodies. Slides were coverslipped in Vectashield Mounting Medium with Dapi (Invitrogen). As control for immunofluorescence, slides were incubated with only the Alexa Fluor 488-conjugated anti-mouse or Alexa Fluor 594-conjugated anti-rabbit antibodies but not with primary antibodies. No signal was detected in these conditions. The results were analyzed on a Leica DM5500B microscope with a HAMAMATSU camera ORGA-ER.
5
Quantifying Skin Phenotypes with OCT
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For analysis of back skin phenotypes, OCT sections were fixed in 4% PFA for 10 min in phosphate-buffered saline (PBS) and washed three times for 5 min in PBS at room temperature. Block the sections with 2.5% NGS, 2.5% NDS in PBS. Primary antibodies against the following proteins were used: β4-integrin (β4, 1:100, BD Biosciences), Lef1 (1:500, Cell signaling), K5 (1:5000, Covance), K1 (1:2000, Covance), and Ki67 (1:500; Abcam). Imaging was performed on a Leica DM5500B microscope with an attached Hamamatsu C10600-10B camera and MetaMorph (version 7.7; MDS Analytical Technologies) software. For all images, single optical sections were used.
6
Microscopic Imaging of Meiotic Spreads
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hybridization signals in mitotic and meiotic metaphase I spreads were examined using a Leica DM5500B microscope equipped with a Hamamatsu ORCA-FLASH4.0 camera and controlled by Leica LAS X software v2.0. Digital images were processed using Adobe Photoshop CS5 (Adobe Systems Inc., San Jose, CA, USA) extended version 12.0 × 64. Polyacrylamide-embedded meiocytes were optically sectioned using the same Leica DM5500B microscope. Z-stacks were processed using the deconvolution module of the Leica LAS X Software package. Images were processed using Fiji (an implementation of ImageJ, a public domain program by W. Rasband available from http://rsb.info.nih.gov/ij/ ).
7
GISH for H. chilense Genome Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromosome preparation and genome in situ hybridization (GISH) were carried out as described previously (Rey et al. 2018 (link)). H. chilense genomic DNA was directly labelled with tetramethyl-rhodamine-5-dUTP (Sigma) by nick translation. Images were taken using a Leica DM5500B microscope equipped with a Hamamatsu ORCA-FLASH4.0 camera and controlled by Leica LAS X software v2.0.
8
Chromosome Preparation and GISH Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromosome preparation and GISH were carried out as described previously (Rey et al. 2018) (link).
Aegilops taushii was used as a probe to label wheat D genome. H. chilense and A. taushii genomic DNA were labelled with biotin-16-dUTP and digoxigenin-11-dUTP, using the Biotinnick translation mix and the DIG-nick translation mix respectively (Sigma, St. Louis, MO, USA) according to the manufacturer's instructions. Images were taken using a Leica DM5500B microscope equipped with a Hamamatsu ORCA-FLASH4.0 camera and controlled by Leica LAS X software v2.0.
Aegilops taushii was used as a probe to label wheat D genome. H. chilense and A. taushii genomic DNA were labelled with biotin-16-dUTP and digoxigenin-11-dUTP, using the Biotinnick translation mix and the DIG-nick translation mix respectively (Sigma, St. Louis, MO, USA) according to the manufacturer's instructions. Images were taken using a Leica DM5500B microscope equipped with a Hamamatsu ORCA-FLASH4.0 camera and controlled by Leica LAS X software v2.0.
9
Microscopy Technique for Chromosome Ideogram
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hybridization signals were examined using a Leica DM5500B microscope equipped with a Hamamatsu ORCA-FLASH4.0 camera and controlled by Leica LAS X software v2.0. Digital images were processed using Adobe Photoshop CS5 (Adobe Systems Incorporated, USA) extended version 12.0 × 64.
The ideogram for H1, H16, H7, H. vulgare and T. aestivum chromosomes was based on the hybridization patterns of the probes used in this work and the morphology of chromosomes previously described (Cabrera et al. 1995; Pedersen and Langridge 1997; Prieto et al. 2004; Kato 2011; Szakács et al. 2013; Komuro et al. 2013; Tang et al. 2014) .
The ideogram for H1, H16, H7, H. vulgare and T. aestivum chromosomes was based on the hybridization patterns of the probes used in this work and the morphology of chromosomes previously described (Cabrera et al. 1995; Pedersen and Langridge 1997; Prieto et al. 2004; Kato 2011; Szakács et al. 2013; Komuro et al. 2013; Tang et al. 2014) .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!