Pgreenpuro

Manufactured by System Biosciences

Sourced in United States

PGreenPuro is a plasmid vector designed for the expression of genes in mammalian cells. It contains a green fluorescent protein (GFP) reporter gene under the control of a strong promoter, allowing for the visualization of transfected cells.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

PGreenPuro vector (26 citations) PGreenPuro lentiviral vector (9 citations) PGreenPuro shRNA vector (8 citations) PGreenPuro shRNA Expression Lentivector (6 citations) PGreenPuro shRNA cloning and expression lentivector (5 citations) PGreenPuro shRNA (4 citations) PGreenPuro™ shRNA Cloning and Expression Lentivector kit (3 citations) PGreenPuro backbone (2 citations) PGreenPuro Lentivector (2 citations)

29 protocols using pgreenpuro

Lentiviral Transduction of miR-744-3p and PDCD4 in LSCC

Check if the same lab product or an alternative is used in the 5 most similar protocols

A stem-loop shRNA with imperfect complementation was constructed according to the antisense miR-744-3p sequence (5′-GACAACGGTGATTGGAGTTGGA-3′). The miR-744-3p shRNA coding sequence was cloned into lentivector pGreenPuro (System Biosciences) to generate the miR-744-3p shRNA expressing vector (pGreenPuro-miR-744-shRNA vector). PDCD4 insert for construction of stable LSCC clone expressing PDCD4 was amplified using Roche FastStart High Fidelity PCR System (Roche Applied Science). The forward primer for PDCD4 insert amplification was: 5′- GCA TAATGGATGTAGAAAATGAGCA-3′, and the reverse primer was: 5′- CGTACTCAGTAGCTCTCTGGTTTAA −3′. The PDCD4 coding sequence was cloned into lentivector pCDH-CMV-MCS-EF1-copGFP (System Biosciences) generating the pCDH-PDCD4 vector. The pGreenPuro-miR-744-shRNA or pCDH-PDCD4 vector as well as their mock vectors was further packaged into lentiviral particles by 293-FT cells (Life technologies) using the Lenti Starter Kit (System Biosciences). Subsequently, the lentiviral particles were transduced into the LSCC cell lines SNU899 and SNU1076 by TransDux™ (System Biosciences).

Li J.Z., Gao W., Lei W.B., Zhao J., Chan J.Y., Wei W.I., Ho W.K, & Wong T.S. (2016). MicroRNA 744-3p promotes MMP-9-mediated metastasis by simultaneously suppressing PDCD4 and PTEN in laryngeal squamous cell carcinoma. Oncotarget, 7(36), 58218-58233.

+ Open protocol

+ Expand

Knockdown of Cxcl13 in MN, Astrocyte, and Microglia Co-Cultures

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two shRNAs targeting the sequence of mice Cxcl13 (Gene Bank Accession: NM_018866) were designed according to Jang et al. [29] . An additional scrambled (SCR) sequence was also designed as a negative control (NC). The recombinant lentivirus containing Cxcl13 shRNA (LV-Cxcl13 shRNA), or NC shRNA (LV-NC) was packaged using pGreenPuro (System Biosciences, Palo Alto, CA). The shRNA-1 and shRNA-2 sequences were reported in Jang et al. [29] . The knockdown effect of the above lentivirus was examined by ELISA on primary Ntg co-cultures of MNs, astrocytes, and microglia.

Trolese M.C., Mariani A., Terao M., de Paola M., Fabbrizio P., Sironi F., Kurosaki M., Bonanno S., Marcuzzo S., Bernasconi P., Trojsi F., Aronica E., Bendotti C, & Nardo G. (2020). CXCL13/CXCR5 signalling is pivotal to preserve motor neurons in amyotrophic lateral sclerosis. EBioMedicine, 62, 103097.

+ Open protocol

+ Expand

Lentiviral Knockdown of FAO Enzymes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The shRNA lentiviral vector pGreenPuro™ (System Biosciences, Mountain View, CA) was used to knock down the key FAO enzymes CPT1A and HADHA. The following were the shRNA target sequences: 5′-GGGAGTACGTCATGTCCATTG-3′ for CPT1A-sh^{20 (link)}; 5′-TCTGTGAATCTCAGAAATTTG-3′ for HADHA-sh1; 5′-CCTGAGAAGGTGATTGGCATG-3′ for HADHA-sh2. As described previously, the shRNA sequences were cloned into pGreenPuro™^{20 (link)}. The negative control was the pGreenPuro™ vector backbone that harbors a scrambled insert sequence (5′-CCTAAGGTTAAGTCGCCCTCG-3′). Recombinant lentivirus was produced by co-transfection into 293TN cells with lentiviral vectors and packaging plasmids using lipofectamine 2000 (Thermo Fisher Scientific). Supernatants were collected 48 hours after transfection and used to infect cells. Forty-eight hours post-infection, the transduced cells were selected with puromycin for additional 5 days before FAO assays.

Ma Y., Wang W., Devarakonda T., Zhou H., Wang X.Y., Salloum F.N., Spiegel S, & Fang X. (2020). Functional analysis of molecular and pharmacological modulators of mitochondrial fatty acid oxidation. Scientific Reports, 10, 1450.

+ Open protocol

+ Expand

PD-1H Silencing in Bone Marrow and Osteoclastogenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

To silence PD-1H expression in mouse bone marrow cells, freshly isolated BMCs were cultured in MEM-alpha medium supplemented with 10% FBS, 1% P/S, 10 ng/ml IL-3, 10 ng/ml IL-6 and 10 ng/ml SCF overnight. On the second day, the medium was changed to MEM-alpha with 10%FBS, 1%P/S, 10 ng/ml IL-3, 50 ng/ml IL-6, 100 ng/ml SCF and 4 μg/ml polybrene, and incubated with pGreenpuro (System Biosciences) empty vector lentiviral control or PD-1H-targeting shRNA (5’-GGACGGTACCTGCTCTCTGAC-3’) lentiviral particles. Cells were selected by GFP sorting^{42 (link)}. On day 14, cells were used for OCL differentiation assay. PD-1H protein and mRNA levels were determined in control and silenced cells by Western blotting and qRT-PCR, respectively.
To silence PD-1H in human OCL, CD34⁺ cells were infected by lentivirus pGreenpuro empty vector (EV) or sh-h-PD-1H (5′-GTCCCTGACTCTCCAAACTTTG-3′)^{41 (link)}. 3 days later, GFP⁺ cells were selected by flow cytometry followed by expansion for 5 days. Cell medium were then changed into human OCL differentiation medium (α-MEM supplemented with 10% FBS, 50 ng/ml human M-CSF and 50 ng/ml human RANKL (R&D Systems, Minneapolis, MN)) and cultured for 21 days followed by WB and TRAP staining respectively^{3 (link)}.

Fu J., Li S., Ma H., Yang J., Pagnotti G.M., Brown L.M., Weiss S.J., Mapara M.Y, & Lentzsch S. (2023). The checkpoint inhibitor PD-1H/VISTA controls osteoclast-mediated multiple myeloma bone disease. Nature Communications, 14, 4271.

+ Open protocol

+ Expand

Stable Depletion of Mettl3 in Mouse SSCs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To stably deplete Mettl3 in mouse SSCs/progenitors, lentiviruses harboring shRNA targeting mouse Mettl3 were packaged, produced, and delivered to cells, following a previous article (Zheng et al., 2020 (link)). In brief, lentiviruses were produced by co-transfecting the cloned shRNA expressing vectors (backbone: pGreenPuro; System Biosciences) and the 2nd generation packaging vectors psPAX2 and pMD2.G into HEK293T cells, and were concentrated using ultracentrifugation. Mouse SSCs/progenitors exposed to 10 μg/ml polybrene (Sigma-Aldrich) and the concentrated virus supernatant at a multiplicity of infection (MOI) of 20 were centrifuged at 3,000 g for 1 h at 32°C, followed by 16 h of incubation at 37°C. About 5 days after lentiviral transduction, cells were harvested for validation or downstream experiments. For construction of the shRNA expressing vectors, a sequence specific to the mouse Mettl3 cDNA (5'-GCTACCGTATGGGACATTA-3') or a scramble sequence (5'-GACACCTACGCAAAACCCT-3') was used.

Lv Y., Li T., Yang M., Su L., Zhu Z., Zhao S., Zeng W, & Zheng Y. (2021). Melatonin Attenuates Chromium (VI)-Induced Spermatogonial Stem Cell/Progenitor Mitophagy by Restoration of METTL3-Mediated RNA N6-Methyladenosine Modification. Frontiers in Cell and Developmental Biology, 9, 684398.

+ Open protocol

+ Expand

Lentiviral Transduction of ALK and HK2 Genes

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The shRNA target sequences for ALK^{43 (link)} and HK2^{58 (link)} (Table 1) were cloned into the shRNA lentiviral vector pGreenPuro (System Biosciences, Mountain View, CA). EML4-ALK and HK2 with Flag-tag at the C-terminus were cloned into the lentiviral vectors pCDH-CMV-MCS-EF1-Puro and pCDH-CMV-MCS-EF1-neo (System Biosciences), respectively. Recombinant lentivirus was produced by co-transfection into 293TN cells with lentiviral vectors and packaging plasmids using lipofectamine 2000 (Life Technologies). Culture supernatants were collected 48 hours after transfection and used to infect target cells. The infected cells were selected with puromycin or G418 to establish stably transduced cells.

Ma Y., Yu C., Mohamed E.M., Shao H., Wang L., Sundaresan G., Zweit J., Idowu M, & Fang X. (2016). A causal link from ALK to hexokinase II overexpression and hyperactive glycolysis in EML4-ALK-positive lung cancer. Oncogene, 35(47), 6132-6142.

+ Open protocol

+ Expand

Lentiviral Transduction of Murine C3, TWIST1, and C3

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine C3 shRNA, human TWIST1 cDNA, or human C3 cDNA carrying lentiviri were produced by the core facility for Molecular cloning and Lentivirus production system in the Department of Cancer Biology at UT MDACC. Briefly, murine C3 shRNA (or scrambled sequence), human TWIST1 cDNA, or human C3 cDNA was cloned into pGreen Puro-Lentiviral vectors (pGreenPuro^™, System Biosciences, Mountain View, CA) and tagged with green fluorescent protein (GFP). Twenty micrograms of these cloned lentiviral vectors were transfected into HEK293T cells along with 15 μg of packaging plasmid (2^nd generation psPAX2, Addgene, Cambridge MA) and 15 μg of envelope plasmid (2^nd generation pMD2G) using FuGENE transfection reagent (Promega, Madison, WI) in accordance with the manufacturer’s protocol. Supernatants containing the lentivirus were collected, filtered, and added to the cancer cells in the presence of 6 μg/ml Polybrene (Promega). Twenty-four hours later, 4 μg/ml of puromycin was added to the media for 7 days. Transduction efficiency of the cells was calculated by dividing the number of GFP-expressing cells by the total number of cells, and was found to be 100% in all of the experiments. Transduced cells were analyzed by qRT-PCR assay to determine the level of C3 or TWIST1 mRNAs.

Cho M.S., Rupaimoole R., Choi H.J., Noh K., Chen J., Hu Q., Sood A.K, & Afshar-Kharghan V. (2015). Complement component 3 (C3) is regulated by TWIST1 and mediates epithelial-mesenchymal transition (EMT). Journal of immunology (Baltimore, Md. : 1950), 196(3), 1412-1418.

+ Open protocol

+ Expand

Lentiviral Knockdown of Complement Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine C3 shRNA, C3aR shRNA, C5aR shRNA, and C5L2 shRNA carrying lentiviri were produced by the core facility for molecular cloning and lentivirus production system in the Department of Cancer Biology at UT MDACC. Briefly, murine C3 shRNA, C3aR shRNA, C5aR shRNA, C5L2 shRNA, or scrambled sequence was cloned into pGreenPuro lentiviral vectors (pGreenPuro; System Biosciences) and tagged with GFP. A total of 20 μg of these cloned lentiviral vectors was transfected into HEK293T cells along with 15 μg of packaging plasmid (2^nd generation psPAX2; Addgene) and 15 μg of envelope plasmid (2^nd generation pMD2G) using FuGENE transfection reagent (Promega) in accordance with the manufacturer’s protocol. Supernatants containing the lentivirus were collected, filtered, and added to the cancer cells in the presence of 8 μg/ml Polybrene (Promega). Twenty-four hours later, 4 μg/ml of puromycin was added to the media for 7 days. Transduction efficiency of the cells was calculated by dividing the number of GFP-expressing cells by the total number of cells and was found to be 100% in all of the experiments. Transduced cells were analyzed by quantitative real-time PCR assay to determine the level of C3 mRNA silencing.

Cho M.S., Vasquez H.G., Rupaimoole R., Pradeep S., Wu S., Zand B., Han H.D., Rodriguez-Aguayo C., Bottsford-Miller J., Huang J., Miyake T., Choi H.J., Dalton H.J., Ivan C., Baggerly K., Lopez-Berestein G., Sood A.K, & Afshar-Kharghan V. (2014). Autocrine Effects of Tumor-Derived Complement. Cell reports, 6(6), 1085-1095.

+ Open protocol

+ Expand

Modulating miR-221 and miR-222 Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For miR-221 or miR-222 overexpression, 2 × 10⁵ HEK293T cells were transfected with 2 μg plasmid (PMIRH221PA-1-GVO-SBI or PMIRH222PA-1-GVO-SBI, System Biosciences, Mountain View, CA, USA) with Lipofectamine 2000 transfection reagent and OptiMEM (both from Invitrogen, Carlsbad, CA, USA) according to manufacturer's instructions. The transfections were performed in triplicates.
A total of 2 × 10⁵ endogenously miR-221−/−222-overexpressing MDA-MB-231 cells was infected with lentiviral particles for inhibition of miR-221 (anti-miR-221) as described [12 (link)]. Replication-defective lentiviral particles were produced by co-transfection of HEK293T cells with the packaging plasmids pMDLg/pRRE, pRSV and the lentiviral expression vector for miR-221 inhibition (MZIP221-PA-1-GVO-SBI, System Biosciences, Mountain View, CA, USA). The lentiviral transduction vector pGreenPuro (control vector, lacks the sequence for miRNA inhibition or overexpression, System Biosciences, Mountain View, CA, USA) was used as an additional control. Three independent infections were conducted.

Falkenberg N., Anastasov N., Schaub A., Radulovic V., Schmitt M., Magdolen V, & Aubele M. (2015). Secreted uPAR isoform 2 (uPAR7b) is a novel direct target of miR-221. Oncotarget, 6(10), 8103-8114.

+ Open protocol

+ Expand

Lentiviral Transduction of Anti-miR-196a

Check if the same lab product or an alternative is used in the 5 most similar protocols

The miRZip-196a anti-miR-196a miRNA construct (MZIP196a-PA-1, System Biosciences, CA, USA) which produces short, single-stranded anti-miR-196a miRNA was cloned into a lentiviral vector pGreenPuro (System Biosciences). Lentivirus production was performed by transfection of the 293TN Cell Line (System Biosciences) with pPACKH1 packaging systems (System Biosciences). The lentiviral particles were harvested from supernatant 48 h post transfection using ultracentrifugation at 4 °C for 2.5 h. The PLC cells were transduced with anti-miR-196a containing lentiviral particles with a multiplicity of infection (MOI) of 2–4. Stable clones were selected with 4 μg/mL puromycin for 2 weeks. The expression of anti-miR-196a lentiviral vectors on PLC cells was evaluated by green fluorescence under a fluorescence microscope. The efficacy of knockdown of miR-196a was confirmed by RT-qPCR.

Wang S.Y., Chen C.L., Hu Y.C., Chi Y., Huang Y.H., Su C.W., Jeng W.J., Liang Y.J, & Wu J.C. (2019). High Expression of MicroRNA-196a is Associated with Progression of Hepatocellular Carcinoma in Younger Patients. Cancers, 11(10), 1549.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!