Peqstar thermo cycler

PCR was carried out using a peqSTAR thermocycler (Peqlab, Erlangen, Germany) as described previously [13 ]. Briefly, 18S ribosomal RNA gene from Cryptosporidium genus (NCBI, Accession No. GQ259149.1) was amplified under the following conditions for analysis: 94 °C for 5 min, 35 cycles of 1 min at 94 °C, 1.30 min at 60 °C, 2 min at 72 °C (Cry18S-S2, 5′ GGTGACTCATAATAACTTTACGG 3′ as forward and Cry18S-As2, 5′ ACGCTATTGGAGCTGGAATTAC 3′ as reverse primers). This was followed by nested amplification of 35 cycles: 1 min at 94 °C, 1.30 min at 60 °C, 2 min at 72 °C and a final extension step of 10 min at 72 °C (Cry18S-S1, 5′ TAAACGGTAGGGTATTGGCCT 3′ as forward and Cry18S-As1, 5′ CAGACTTGCCCTCCAATTGATA3′ as the reverse. Aliquots of 20 ρM of each primer were added in a volume of 50 μl containing 20 mM (NH4)2 SO4, 75 mM Tris–HCl (pH. 8.8), 1 mM MgCl2, 0.2 mM dNTP mix, 1.2 units of thermostable DNA polymerase (Invitrogen, Mannheim, Germany), and 1 μl of the template (genomic DNA). The amplification products were subjected to electrophoresis on 1% agarose gel stained with ethidium bromide and visualized under a UV transilluminator. The expected PCR band size after nested PCR was approximately 240 bp.

Amount of 10 µg RNA was incubated with 5 µL of DNAse buffer and 1 µL of DNAse at 37 °C for 30 min (DNA-free™ DNA Removal Kit, Ambion, Bleiswijk, Netherlands). After addition of DNAse inactivation reagent tubes were kept at room temperature with occasional vortexing for 5 min. Samples were centrifuged (14,000 rpm, 4°C, 2 min) and the concentration and quality of supernatant were analyzed on Nanodrop (ND-1000, Witec AG, Sursee, Switzerland).
Synthesis of cDNA was done with a Transcriptor High Fidelity cDNA synthesis kit (Roche). RNA (1 µg) was incubated with 60 µM random hexamer primers, in 11.4 µL of total sample volume, at 65 °C for 10 min. The mixture of Transcriptase reaction buffer 5×, Deoxynucleotide mix, DTT, Protector RNAse inhibitor, and Transcriptor High Fidelity Reverse Transcriptase was added to each tube according to manufacturer instructions. Synthesis of cDNA was completed by incubating the mixture at 50 °C for 30 min and 85 °C for 5 min (Peqstar thermocycler, Peqlab, Erlangen, Germany).

For conventional PCR, Phire Green Hot Start II PCR Master Mix (Invitrogen, Carlsbad CA USA) and the primers 457F CGGGCCAGACAAAATTGACC and 1223R AACAGGAAATACAAGGCGGC were used in a peqSTAR Thermocycler (VWR, Darmstadt, Germany) with the following cycling conditions: 30 s at 98 °C, 35 cycles each of 10 s at 98 °C, 30 s at 64 °C, 2 min at 72 °C and final elongation 10 min at 72 °C. Corresponding bands (751 bp) were purified from a 1.5% agarose gel with the QIAquick Gel Extraction Kit (Qiagen) and used for sequencing reactions (BigDye Terminator v3.1 Cycle Sequencing Kit, Applied Biosystems, Darmstadt, Germany). The reaction products were purified using NucleoSEQ columns (Macherey–Nagel) and sequenced on an ABI PRISM® 3100 Genetic Analyzer (Life Technologies, Darmstadt, Germany). Obtained sequences were assembled using the Geneious software, v11.1.5.

Cells were scraped from plastic-bottom dishes and lysed in Qiazol^TM lysis reagent, and total RNA was isolated with the miRNeasy^® Kit (Qiagen, Hilden, Germany). RNA yield and quality were assessed with the NanoDrop^TM 2000 (Thermo Fisher Scientific, Waltham, MA, USA). Subsequent gDNA wipeout and cDNA synthesis using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) were carried out in a peqStar Thermocycler (VWR, Radnor, PA, USA). cDNA was diluted to a working concentration of 10 ng per reaction volume for qPCR. qPCR was performed using the TaqMan-System (TaqMan^TM Gene Expression Master Mix and TaqMan^TM Assays; Thermo Fisher Scientific, Waltham, MA, USA; primers listed in Table S1) according to the manufacturer’s instructions, and a Bio-Rad CFX384 Touch Real-Time PCR Detection System (Bio-Rad Laboratories Inc., Hercules, CA, USA). GenEx 5.4.4. (MultiD, Gothenburg, Sweden) was used for efficiency correction on all primer sets, followed by relative quantification of gene expression with the 2^−ΔΔCt quantification method. GAPDH served as the housekeeping gene. All procedures were carried out according to the MIQE guidelines [13 (link)].

RNA was isolated from snap-frozen myocardial tissue using the TRIzol Reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA). After incubation of tissue in 1 mL TRIzol Reagent, addition of 200 µL chloroform and centrifugation at 4 °C and 12,000 rcf for 15 min, the aqueous phase was transferred into 500 µL isopropanol. Following centrifugation, the supernatant was discarded, and the RNA-containing pellet was washed in 1 mL 75% ethanol. The RNA-containing pellet was air-dried and then resuspended in 50 µL diethyldicarbonat (DEPC)-treated water (Thermo Fisher Scientific Inc.). The reverse transcription was performed according to the manufacturer instructions using the Applied Biosystems^TM High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific Inc.). In brief, 2 µL 10× RT Buffer, 0.8 µL 25× dNTP, 2 µL 10× RT random primers, 1 µL MultiScribe^TM Reverse Transcriptase, 1 µL RNase inhibitor and 3.2 µL DEPC-treated water were mixed with 10 µL RNA. After centrifugation, the reverse transcription mix was incubated in the peqSTAR Thermocycler (VWR International, Darmstadt, Germany) for 10 min at 25 °C and 120 min at 37 °C. The concentration and purity of the nucleic acids was determined using the Infinite 200 PRO microplate reader and the i-control^TM 1.12 software (both Tecan Trading AG, Männedorf, Switzerland).