Hotstart q5

Semi-quantitative end-point PCR (HotStart Q5, New England Biolabs Inc., Ipswich, MA, USA) employed 25 ng cDNA in 50-μL reactions) and 10 ng control plasmids (pCR2.1_HBB_N, pCR2.1_HBB_A) for 25, 30 and 35 cycles, before further analyses. Quantification of normal and aberrant transcript amounts by integration of fluorescent band intensities (SafeRed, GeneCopoeia, Rockville, MD, USA) was performed using ImageJ [36 (link)] after agarose gel separation and purification (QIAquick PCR Purification kit, Qiagen, Hilden, Germany). In parallel, 50 ng of PCR products were analyzed by cycle sequencing (BigDye v1.1, Applied Biosystems, Thermo Fisher Scientific, Carlsbad, CA, USA) and decomposition of sequence traces using the TIDER [19 (link)] HDR quantification algorithm and the ICE knock-in score algorithms [20 ], providing as wild-type control the sequence trace for plasmid pCR2.1_HBB_N, and as sham input for the initial detection of the aberrant sequence insert a suitable gRNA sequence (GTGGTGAGGCCCTGGGCAGG) and HDR donor sequence (GGTGGTGAGGCCCTGGGCAGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTT).

In order to test the utility of NPT and V. natriegens as a host for cloning, we designed two arbitrary Gibson assembly and KLD reactions, creating final plasmids pDS5.43 and pDS5.44, respectively. The requisite PCRs were completed using NEB Hot Start Q5. PCR product for Gibson assembly was cleaned using a Zymo Clean & Concentrator kit and then used in a NEBuilder HiFi DNA Assembly reaction as described by the manufacturer.
In the KLD reaction (NEB KLD Enzyme Mix), pDS5.30 is PCR amplified using primers TransientKan_F and DelGFP_R in order to excise the GFP sequence from pDS5.30, producing plasmid pDS5.44 and an easy-to-visualize change from green to white cells. This PCR product is used directly in the KLD reaction without further cleaning, per the manufacturer’s instruction. In both, 2 μL of reaction product is added directly to the competent cells in media, just as with plasmid DNA in the previously described NPT protocol.
Miniprep extraction of plasmid DNA from V. natriegens was accomplished using the E.Z.N.A Plasmid DNA Mini Kit I produced by Omega Bio-Tek, following the manufacturer’s instructions.
For the demonstration of producing single colonies within a standard workday, colonies are imaged using an Azure Biosystems Gel Imaging System. The image contrast is altered in order to highlight the presence of colonies and facilitate measurement of their size.