Shc202

Bacterial stocks containing lentiviral shRNA for a target gene were purchased from MilliporeSigma (MISSION shRNA library, Supplementary Data 7). Lentiviral vector carrying shRNA for KD or non-target sequence (MilliporeSigma, SHC202) was transfected to HEK293T cells at 70% confluency using GenJet™ In Vitro DNA Transfection Reagent (SignaGen Laboratories, SL100488), according to the manufacturer’s instructions. After 18 h, HEK293T medium was replaced with TSC medium. Viral supernatants were harvested 24 h and 48 h following medium replacement. To KD a target gene, TSC were infected in viral supernatant containing polybrene (Santa Cruz Biotechnology, sc-134220) at a final concentration of 10 μg/mL. After 18 h, the infected cells were induced to differentiate into EVT using EVT differentiation media supplemented with puromycin at a final concentration of 1 μg/mL. For the time-course KD of TFAP2C, the viral media was applied to TSC for early knockdown (Early-KD), and to differentiating cells at day 3 (Mid-KD) and day 5 (Late-KD). The differentiation media supplemented with puromycin was used according to the specific differentiation time, replacing the media after 18 h of infection.

Undifferentiated SGBS cells were plated at 50% confluence in 6-well plates and infected with commercial lentiviral particles targeting either human ABCG1 (TRCN0000420907; Sigma) (TAGGAAGATGTAGGCAGATTG) or non-target controls (SHC202) (CCGGCAACAAGATGAAGAGCACCAACTC) and (TRCN0000158395; CCTACAGTGGATGTCCTACAT) (Sigma Aldrich). The transduced cells were selected in media containing 1 μg/ml puromycin for 6 days. Stable ABCG1 KD and control cells were then cultured and differentiated into mature adipocytes, as described above.

The ORF for mouse C17orf96 (E130012A19Rik) was cloned via PCR from mES cell cDNA. The ORF from human C17orf96 were synthesized from GeneScript. The ORF for human PHF19, RBBP4, RBBP7, EZH1 and EZH2 were cloned via PCR using cDNA from HeLa-S cells. The SUZ12 construct was a kind gift from Danny Reinbergs laboratory. Lentiviral shRNA constructs for mouse C17orf96 were created by cloning hairpins (shRNA #1: 5ʹ-GGAGCATCGATTCTGAAATTT-3ʹ and shRNA #2: 5ʹ-ATGATGGAAGATGGAATAAAT-3ʹ) into the pLKO.1 vector. SHC202 (Sigma-Aldrich, St Louis, MO, USA) was used as shRNA control. Quantitative PCR primers for mouse C17orf96 are presented in Supplementary Table S3.

pLKO vector expressing shRNA targeting 3′UTR of RAD52 (shRAD52) (Sigma, SHCLND-NM_134424.2–1462s21c1) or Non-Target shRNA control (shCtrl) (Sigma, SHC202) were used. The oligonucleotide sequences used for shRNA are shown in Supplementary Table S1. Viral particles for both shRAD52 and shCtrl were made as mentioned above using HEK293T cells. For stable integration of shRNA, cells were infected with viral particles in culture medium containing 8 μg/ml polybrene. Culture medium was changed after 24 h. Next day, cells were selected using 2 μg /ml (MDA-MB-436) or 1 μg/ml (HCC1937 and CAPAN1) of puromycin for 7 days, with medium change every 2 days.