Prk5 ha ubiquitin k48r

The PH-RFP and 2XFYVE-GFP reporter constructs were a generous gift from Dr. Pietro de Camilli (Yale University School of Medicine, New Haven, CT). The PH-RFP and 2XFYVE-GFP constructs contain a PH domain derived from Akt1 showing preferential binding to PI(3,4,5)P3 > PI(3,4,)P2 and a FYVE domain from HRS binding PI(3)P, respectively. pcDNA3-FLAG PTEN was a gift from Jaewhan Song (Addgene plasmid #78777). mCherry-Rab5WT was a gift from Gia Voeltz (Addgene plasmid #49201). mCherry-Rab5DN (S34N) was a gift from Sergio Grinstein (Addgene plasmid #35139). Rab5-GFP lentiviral particles were purchased commercially (AMS Biosciences). mCherry-FKBP-MTM1 was a gift from Tamas Balla (Addgene plasmid #51614). pCMV5B-Flag-SMURF2 C716A was a gift from Jeff Wrana (Addgene plasmid #11747). pRK-Myc-SMURF2 was a gift from Ying Zhang (Addgene plasmid #13678). Ubiquitin WT was a gift from Rachel Klevit (Addgene plasmid #12647). pRK5-HA-Ubiquitin-K48R was a gift from Ted Dawson (Addgene plasmid #17604).

The pcDNA3.1-HA-SUMO1–4, SENP3, TOLLIP; pcDNA3.1-Flag-p62, NDP52, OPTN, NBR1, NIX, TOLLIP, TAX1BP1; pcDNA3.1-ACE2-HA, and pcDNA3.1-ACE2-Flag as well as its indicated truncation mutants were constructed by standard molecular biology technique. The pRK5-HA-Ubiqutin-K48 (#17605) and pRK5-HA-Ubiquitin-K48R (#17604) were purchased for Addgene. Expression plasmids for PIAS1, PIAS2α, PIAS2β, PIAS3, and PIAS4 were provided by Dr. Hong Tang (University of Chinese Academy of Sciences). Construct coding for ACE2 was cloned into the FG-EH-DEST (provided by Dr. Xiaofeng Qin’s laboratory) for retroviral expression. Plasmids encoding K187R, K234R, K465R, K481R, and K534R mutants of ACE2 were generated using pcDNA3.1-ACE2-Flag as a template by site-directed mutagenesis using the Mut Express® II Fast Mutagenesis Kit V2 (Vazyme, cat. C214-01), and the primers could be found in Supplementary Table 2. Transient transfection into HEK293T cells was conducted using Lipofectamine 2000 (Invitrogen, cat. 11668019). Chemically synthesized 21-nucleotide siRNA duplexes were acquired from Sangon Biotech and transfected using Lipofectamine RNAiMAX (Invitrogen, cat. 13778030). Detailed information of all siRNA sequences could be found in Supplementary Table 3.

lentiCRISPR v2, pCMV-VSV-G, psPAX, pcDNA3-myc-Skp2, CMV10-3xFlag Skp2 delta-F, pSuper-retro-puro, HA-Ubiquitin, pRK5-HA-Ubiquitin-K48R and pET3a-Ubiquitin-K63R plasmids were purchased from Addgene, Flag–His-SKP2, Flag-His-ΔN-SKP2, Flag-His-PDCD4 and Flag-His-PDCD4(Ser67)plasmids were purchased from Biosune Biotechnology. The sgRNA and shRNA sequences for SKP2 were as follows: sgSKP2:AGAATCCAGAACACCCAGAA; shSKP2:GATCCCCGCCTAAGCTAAATCGAGAGAATTCAAGAGATTCTCTCGATTTAGCTTAGGCTTTTTGGAAA. shRNA sequences for PDCD4 were as follows: CCGGGCGGTTTGTAGAAGAATGTTTCTCGAGAAACATTCTTCTACAAACCGCTTTTTG.