Gene expression DNA microarray analysis was performed by LC Sciences (Houston, TX, USA) using Agilent Rat Oligo Microarray (V2), 4 × 44 K (G2519F-019161). Total RNA was extracted from PC12 cells after treatment with DMSO (negative control) or ABG-001 for 12 h by using RNA Isolation Kit (Norgen, Thorold, ON, Canada) according to the Manufacturer’s instructions, and purified by RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA samples of each group were used to generate biotinylated cRNA targets and were then hybridized with the slides. After hybridization, the slides were scanned with the Agilent Microarray Scanner G5761A (Agilent Technologies, Santa Clara, CA, USA). Data were extracted with Feature Extraction software 12.0.3.1 (Agilent Technologies, Santa Clara, CA, USA). Raw data were normalized by Quantile algorithm. Genes with p-value < 0.05 were selected for further analysis. GO/KEGG pathway enrichment analyses were carried out using Fisher’s exact test of the target genes.
Rna isolation kit
Manufactured by Norgen Biotek
Sourced in Canada
The RNA isolation kit from Norgen Biotek is designed to efficiently extract and purify high-quality RNA from a variety of sample types. The kit utilizes a simple and rapid spin-column procedure to isolate total RNA, including small RNAs, from cells, tissues, and other biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (2 mentions)
Cel mir 39, by Norgen Biotek (2 mentions)
Cdna synthesis kit, by Norgen Biotek (2 mentions)
Universal primer reverse, by Norgen Biotek (2 mentions)
Sybr green, by Ampliqon (2 mentions)
Feature extraction software 12, by Agilent Technologies (1 mentions)
Agilent microarray scanner g5761a, by Agilent Technologies (1 mentions)
Quantstudio 12k flex real time pcr system, by Thermo Fisher Scientific (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Superscript 3 first strand synthesis reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
First strand cdna synthesis kit, by OriGene (1 mentions)
Sod kit, by Randox (1 mentions)
Gpx kit, by Randox (1 mentions)
Nanodrop 2000 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Nebnext poly a kit, by New England Biolabs (1 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
Norepinephrine, by Merck Group (1 mentions)
Butoxamine, by Merck Group (1 mentions)
Prazosin, by Merck Group (1 mentions)
12 protocols using rna isolation kit
1
Transcriptome Analysis of ABG-001 Treatment in PC12 Cells
2
Quantifying Circular RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the blood through the Norgen RNA isolation kit (Norgen, Canada). The complementary DNA (cDNA) was reverse transcribed from the 500 ng total RNA per sample using Superscript® III First-Strand Synthesis Reverse Transcriptase (Invitrogen, Carlsbad, CA, United States) and primed using random primers. Real-time-qPCR (RT-qPCR) reactions were undergone in triplicate for each sample through the Power SYBR ® Green PCR Master Mix (Invitrogen, Carlsbad, CA, United States) within a QuantStudio 12 K Flex Real-Time PCR System (Applied Biosystems, Foster City, CA, United States). The primers are listed in Table 3 . The thermal cycling conditions include an initial denaturation step at 95°C for 3°min, followed by 39 cycles of 10 s at 95°C and 30 s at 58°C. The expression levels of circRNAs were normalized with the linear transcript, GAPDH, or convergent amplicon of the host gene.
3
Fungal DNA/RNA Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fungal mycelium was grown on PDA plates with cellophane paper. Mycelium were scratched from the plates, grounded in liquid N2 and used for DNA or RNA isolation. DNA was isolated using DNA lysis buffer at pH 8.0 containing Tris-HCl (200 mM), NaCl (250 mM), EDTA (25 mM), and SDS (0.001% v/v). DNA was digested with RNAse and used for PCR. RNA was extracted using the Plant/Fungal RNA isolation Kit (cat–25800, Norgen, Canada), following the manufacturer’s instructions, followed by DNase treatment (Qiagen kit, cat–79254, Hilden, Germany).
4
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using the RNA Isolation Kit (NORGEN Biotek Corp). First-strand cDNA was synthesized using the First Strand cDNA Synthesis Kit (OriGene Technologies) mixed with 2× SYBR Green PCR Master Mix and gene-specific forward and reverse primers and then subjected to real-time PCR quantification. All reactions were performed in triplicate. The relative amounts of mRNAs were calculated by using the comparative cycle threshold method. All genes were normalized to the abundance of cyclophilin mRNA. Immunohistochemistry for IL1-β expression in cancer and atherosclerotic tissues was performed as previously described [16 (link)].
5
Statistical Analysis of Microbicidal Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Statistical analyses were performed with the help of GraphPad PRISM software (v7.0). Unless specified, for microbicidal assay and RNA quantifications studies using cell line, we used two-way analysis of variance (ANOVA) with either Tukey’s or Sidak’s multiple-comparison test to evaluate the significance of observed differences. Analysis of differences in total RNA recovery using Norgen RNA isolation kit was performed by one-way ANOVA with Sidak’s multiple-comparison test. Differences in paired Ct values for qPCR internal control and SARS-CoV-2 genes were scored using paired t test. Statistical comparison of patient diagnostic parameters and ROC curves was performed by 2-sample Z test using online tool https://epitools.ausvet.com.au/ztesttwo (27 (link), 28 (link)). In every statistical analysis, a P value of ≤0.05 was considered significant.
6
Mitochondrial Antioxidant Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The material used and their sources were as follows: MitoQ capsule (MitoQ Ltd, New Zealand), superoxide dismutase (SOD) kit (Randox, #RS504, UK), glutathione peroxidase (GPx) kit (Randox, #SD125, UK), nitric oxide (NO), RNA isolation kit (Norgen Biotek, #17200, Canada), cDNA synthesis kit (Norgen Biotek, #54410, Canada), cel-miR-39 (Norgen Biotek, #59000, Canada), SYBR green (Ampliqon, #A325402, Denmark), universal primer (reverse) (Norgen Biotek, #59000, Canada), and primers (MetaBion, Germany).
7
Transcriptome Analysis of FAZ Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from FAZ tissues using an RNA isolation kit (Norgen Biotek, Thorold, ON, Canada). RNA quality was verified and quantified using NanodropTM (2000/2000c Spectrophotometers, Thermo Fisher Scientific, Wilmington, DE, USA). One microgram of mRNA was used as a template for first-strand cDNA synthesis using NEBNext® Poly(A) kit (NEB #E7490, New England Biolabs, Inc., Ipswich, MA, USA) and NEBNext® ultra™ II directional RNA library prep kit for Illumina (NEB #E7760, New England Biolabs, Inc., Ipswich, MA, USA). Paired-end sequencing (75 bp) was performed for four samples using NextSeq 500/550-mid output kit v2.5 (2 × 75 cycles) on an Illumina NextSeq500 sequencer (Norgen Biotek, Thorold, ON, Canada).
8
Gastric Cancer Cell RNA Extraction and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from gastric cancer cells using the RNA Isolation Kit (NORGEN, cat no: 17270) according to the manufacturer's instructions and quantified it with a spectrophotometer. 500 ng of cDNA was synthesized from the RNA template using a reverse transcription kit (BIO‐RAD, #1708841), and PCR amplification was performed by adding Taq polymerase, cDNA template, primers for genes, and reference genes to the reaction mixture (QIAGEN, #339347). The primer sequences can be found below. KCND2 F: CCTACATGCAGAGCAAGCG, R: GTG GTTTTCTCCAGGCAGTG; human GAPDH: F: TGACTTCAACAGCGACACCCA, R: ACCCTGTTGCTGTAGCC AAA; mouse Arg1 F: CTCCAAGCCAAAGTCCTTAGAG, R: GGAGCTGTCATTAGGGACATCA; mouse Mrc1 F:CT ATGCGCTGCGTTATCACAG, R: AAAGAAAGTGACGAGGCAGAG; mouse IL‐6 F: TCTGGGAAATCGTGGAAATGAG, R: TCTCTGAAGGACTCTGGCTTTGTC; mouse IL‐10 F: CTTACTGACTGGCATGAGGATCA, R: GCAGCTCTAGGAGCATGTGG; mouse VEGFɑ F: CTGCCGTCCGATTGAGACC, R: CCCCTCCTTGTACCACTGTC; mouse GAPDH F: TACAGCAACAGGGTGGTGGAC, R: TGGGATAGGGCCTCTCTTGCT.
9
Randomized Trial of MitoQ Cardiovascular Effects
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this double-blind randomized clinical trial study, the materials used and their
sources were MitoQ (MitoQ Ltd., New Zealand), TAC, MDA, IL-6 kit (Thermo Fisher
Scientific, USA), RNA isolation kit (Norgen Biotek, Cat. No. 17200, Canada), cDNA
synthesis kit (Norgen Biotek, Cat. No. 54410, Canada), cel-miR-39 (Norgen Biotek, Cat. No.
59000, Canada), SYBR green (Ampliqon, Cat. No. A325402, Denmark), universal primer
(reverse) (Norgen Biotek, Cat. No. 59000, Canada), and forward primers (Metabion,
Germany). MitoQ capsules contained MitoQuinol (as MitoQuinol Mesylate) 20 mg as active
ingredient, and microcrystalline cellulose (MCC), tapioca, and silicon dioxide
(SiO2) as excipients. The role of these excipients compounds in capsule
formulation are: SiO2 as an anti-caking agent, adsorbent, or glidant to allow
powder to flow freely; MCC as a segregation inhibitor to improve drug content uniformity;
and tapioca starch, as diluent due to its good flow ability. These compounds are generally
inactive ingredients especially when used in low amounts, and we did not find any evidence
for them to have side effects on the cardiovascular system.
sources were MitoQ (MitoQ Ltd., New Zealand), TAC, MDA, IL-6 kit (Thermo Fisher
Scientific, USA), RNA isolation kit (Norgen Biotek, Cat. No. 17200, Canada), cDNA
synthesis kit (Norgen Biotek, Cat. No. 54410, Canada), cel-miR-39 (Norgen Biotek, Cat. No.
59000, Canada), SYBR green (Ampliqon, Cat. No. A325402, Denmark), universal primer
(reverse) (Norgen Biotek, Cat. No. 59000, Canada), and forward primers (Metabion,
Germany). MitoQ capsules contained MitoQuinol (as MitoQuinol Mesylate) 20 mg as active
ingredient, and microcrystalline cellulose (MCC), tapioca, and silicon dioxide
(SiO2) as excipients. The role of these excipients compounds in capsule
formulation are: SiO2 as an anti-caking agent, adsorbent, or glidant to allow
powder to flow freely; MCC as a segregation inhibitor to improve drug content uniformity;
and tapioca starch, as diluent due to its good flow ability. These compounds are generally
inactive ingredients especially when used in low amounts, and we did not find any evidence
for them to have side effects on the cardiovascular system.
10
Total RNA Isolation from Venous Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA from venous blood samples was isolated through a Norgen RNA isolation kit (Norgen, Canada) based on the manufacturer’s instructions and purified using an RNeasy Mini Kit (Qiagen, Germany). The integration of total RNA was determined using an Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, US).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!