Lenti x lentivirus concentrator

Ndufs8 and control short-hairpin RNA lentiviral plasmids were purchased from Sigma. Lentiviral vectors, along with packaging plasmids (MDL/RRE, Rev, and VSV-G), were transfected into HEK293T cells using Lipofectamine 3000 (Invitrogen). Three days after transfection, the viral supernatants were collected, mixed with a Lenti-X lentivirus concentrator (Clontech), and incubated overnight at 4 °C. On the following day, the virus was concentrated by centrifugation at 1500 × g for 60 min at 4 °C. The concentrated viruses were added to the cultured MBs to suppress Nudfs8 expression. Seventy-two hours after induction, Ndufs8-inhibited MBs were selected using puromycin.

Lentiviral plasmid was packaged as previously described (Xie et al., 2019 (link)). Briefly, the lentivirus packaging plasmids PMD2.G and psPAX2 (Addgene ID: 12259 and 12260) were co-transfected with the carrier plasmid to HEK293T cells with linear polyethylenimine (Polysciences). Supernatant was collected 72 hr after transfection and filtered with a 0.45 μm filter. The virus was further purified by using Lenti-X lentivirus concentrator (Clontech).

CD90-overexpression lentiviral plasmids (sequence: NM_001311162.2) and shRNA lentiviral plasmids targeting CD90 (target sequence: CACCAGCAAATACAACATGAA) were purchased from VectorBuilder (Tokyo, Japan). We transfected lentiviral vectors and packaging plasmids (MDL/RRE, Rev, and VSV-G) into HEK 293T cells with Lipofectamine 3000 (Invitrogen). Additionally, we collected the viral supernatants 2 days after transfection and concentrated them with Lenti-X lentivirus concentrator (Clontech). To titrate those lentiviral supernatants, we used a Lenti-X p24 titer kit (Takara). We transfected them to MYOD1-UDCs following multiplicity of infection of 100. MYOD1-UDCs were exposed to the growth medium with lentivirus for 48 h and selected by culturing in the growth medium with 10 µg/mL blasticidin (Wako).