Multiplex PCR was carried out as described by Chew et al. [9 (link)]. Generally, 15 μl of PCR reagent mixture containing 20 mM of Tris–HCl, 20 mM of KCl, 5 mM of (NH4)2SO4, 3.0 mM of MgCl2, 0.2 μM of each dNTP, pooled primers mixture, 1 U of Maxima® Hot Start Taq DNA polymerase (Thermo Scientific, USA), and 1.5 μl (~10 ng) of template DNA were used in the detection study. PCR amplification was carried out with an initial denaturation step at 95°C for 5 min; 35 repeated cycles at 95°C for 30 sec, 56°C for 30 sec, 65°C for 40 sec, followed by a final extension at 65°C for 10 min using Mastercycler® Gradient 5331 (Eppendorf, Hamburg, Germany). The amplified products were visualized on ethidium bromide stained 3% (w/v) agarose gel (Promega, Madison, WI) and gel image was captured using Gel Doc™ 2000 Gel Documentation System (Bio-Rad, USA).
Gel doc 2000 gel documentation system
Manufactured by Bio-Rad
Sourced in United States
The Gel Doc 2000 is a gel documentation system designed for capturing and analyzing images of electrophoresis gels. It features a charge-coupled device (CCD) camera, a motorized zoom lens, and high-resolution image capture capabilities. The system is used to document and analyze DNA, RNA, and protein samples separated by gel electrophoresis.
Automatically generated - may contain errors
Lab products found in correlation
Maxima hot start taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Mastercycler gradient 5331, by Eppendorf (1 mentions)
Agarose gel, by Promega (1 mentions)
Sds page gel, by Bio-Rad (1 mentions)
Biomax light film, by Kodak (1 mentions)
Pierce ecl western blotting substrate, by Kodak (1 mentions)
Nitrocellulose membrane, by Bio-Rad (1 mentions)
Mwco 12400, by Merck Group (1 mentions)
Precision plus protein dual xtra standard, by Bio-Rad (1 mentions)
Mini protean tgx precast gel, by Bio-Rad (1 mentions)
Bionumeric, by bioMérieux (1 mentions)
Chef dr 3 system, by Bio-Rad (1 mentions)
Superscript 3 reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
Rnase inhibitor, by Promega (1 mentions)
Dithiothreitol (dtt), by Merck Group (1 mentions)
Rnasin plus rnase inhibitor, by Promega (1 mentions)
Rna lysis buffer, by Zymo Research (1 mentions)
Rna microprep kit, by Zymo Research (1 mentions)
Itaq universal sybr green supermix, by Bio-Rad (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
10 protocols using gel doc 2000 gel documentation system
1
Multiplex PCR Amplification and Visualization
2
Gelatinase Activity Assay in PC3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MMP-9 and MMP-2 activities were measured using the gelatin zymography method. The medium containing the respective cells was collected and then centrifuged to remove the residues (400 g, 5 min at 4 °C). Then, 40 μL of the clarified supernatant was mixed with 1 mL of 4× sample buffer (1 mL of 25 mM Tris-HCl; 0.8% sodium dodecyl sulfate; 4% glycerol; and 0.001% aqueous bromophenol; pH 6.8. Cell line (PC3) was electrophoresed on 7% polyacrylamide gel with copolymerized gelatin substrate. Then, 24 h later, the gel was placed in an enzyme-activating solution and in a staining solution (10% acetic acid, 5% methanol, and 0.5% coomassie blue R-250, at dH2O) for at least 1 h or until a uniform dark blue gel. Afterward, the gel was fixed with a solution (5% acetic acid, 10% methanol in dH2O) and stained with coomassie brilliant blue to reveal clear bands. Gels were photographed by Gel Doc 2000 gel documentation system (Bio-Rad) and quantitative analysis was performed with densitometry software. Each group (prostate cancer and taraxasterol treatment) was evaluated in two replications.
3
Immunoblotting Analysis of Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed in lysis buffer (phosphate-buffered saline (PBS) containing 1% Triton X-100, 2 mM PMSF, 1 mM pepstatin, 2 μM antipain, 1 μM leupeptin, and 0.3 μM aprotinin) for 30 min at 4°C. The cells were then removed using a cell scraper, and the nuclei eliminated by centrifugation at 20,000x g for 5 min at 4°C. Protein concentrations were measured using a BCA protein assay kit. Equal amounts of protein from each extract were subjected to reducing conditions, and megalin, E-cadherin or ß-tubulin were immunodetected as previously described [35 (link), 62 (link)]. The immunoblots were visualized using the Pierce enhanced chemiluminescence (ECL) system, and densitometric analysis was performed using the Gel Doc 2000 Gel Documentation System and Quantity One version 4 software (BioRad, CA, USA). The β-tubulin signal was used to normalize protein levels.
4
Western Blot Analysis of Protein Extracts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell extracts were prepared as described previously [28 (link)]. Briefly, exponentially growing cells were lysed with M-PER Mammalian Protein Extraction Reagent supplemented with Halt Protease Inhibitor Cocktail according to the manufacturer’s instructions. The concentration of proteins in each sample was quantified with the BCA Protein Assay Kit according to the manufacturer’s protocol. Protein lysates (30 µg), immunoprecipitate, or tubulin fraction extracts were separated on 10% SDS-PAGE gels (Bio-Rad, CA, USA) and electroblotted (120 min; 200 mA; 4 °C) onto nitrocellulose membranes (Bio-Rad). The membranes were blocked with 5% BSA in PBS (2 h; RT), incubated with primary antibodies (overnight; 4 °C), and after washing incubated with horseradish peroxidase-conjugated secondary antibodies (1 h; RT). Chemiluminescence detection proceeded with Pierce ECL Western Blotting Substrate and Kodak BioMax Light Film (Eastman Kodak, Rochester, NY, USA). Protein bands were scanned (HP Scanjet G4050) and quantified using Gel Doc 2000 gel documentation system (Bio-Rad).
5
Protein Purification via Dialysis and SDS-PAGE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The resulting supernatant obtained from the isolation of proteins was subjected to dialysis (dialysis bags, MWCO 12400, 99.99%, Sigma-Aldrich, Germany) to remove all impurities (excess of salts, ions). The process of dialysis was carried out using a magnetic stirrer at 4°C for 24 hours. Polyacrylamide gel electrophoresis under denaturing conditions (SDS-PAGE) was conducted according to the Laemmli method [10 ] in 4% stacking gel and 20% separating gel (Mini-PROTEAN TGX Precast Gels, Bio-Rad). To determine the molecular weight, an appropriate molecular weight marker (Precision Plus Protein Dual Xtra Standards, Bio-Rad) was used. To visualize protein bands, the gels were stained with Coomassie Brilliant Blue R-250. Electrophoretically separated proteins were documented with GelDoc 2000 Gel Documentation System (Bio-Rad, France).
6
PFGE Analysis of Vibrio cholerae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PFGE was performed using the PulseNet recommended procedure. [13 ] The plugs containing agarose embedded V. cholerae DNA were digested with 50 Units/µl of NotI (Takara). For digestion of Salmonella Braenderup H9812 the molecular size marker, XbaI (15 Units/µl) was used and the DNA fragments were separated electrophoretically under the contour-clamped homogeneous electric field (CHEF) on a CHEF DRIII system (Bio-Rad) on 1% PFGE grade agarose gel in 0.5xTBE (44.5 mM Tris/HCl, 44.5 mM boric acid, 1.0 mM EDTA, pH 8.0) at 14°C. Following electrophoresis, the gels were stained for 30 min in Elix MilliQ water (Millipore, Bangalore, India) containing 1.0 µg ethidium bromide, destained in Elix MilliQ water for 15 min and photographed under UV light using the Gel Doc 2000 gel documentation system (Bio-Rad). DNA fingerprint patterns were analyzed using a computer software package, Bionumeric (Applied Maths, Belgium). Fingerprint patterns were typed on the basis of banding similarity using Dice similarity coefficient and unweighted-pair group method using average linkages (UPGMA) clustering methods.
7
RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were washed with cold PBS and lysed in an RNA Lysis Buffer (Zymo Research) containing a DTT (Sigma-Aldrich) and RNase inhibitor (Promega AG). Total RNA was extracted using the RNA MicroPrep kit (Zymo Research) following the manufacturer’s instructions. cDNA synthesis was performed using 1000 ng RNA, in the presence of random primers, dNTP mix, and RNasin Plus RNase inhibitor (all from Promega AG) using the SuperScript III Reverse Transcriptase Kit (Thermo Fisher Scientific) and following the three-step program (25 °C 5 min, 50 °C 1 h, and 70 °C 15 min). Real-time PCR was performed using the iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories) with the CFX Connect Real-Time PCR Detection system (Bio-Rad Laboratories). The primers that were used in this study are listed in Table 1 . Primers were synthesized using Microsynth AG, (Balgach, Switzerland). The data were analyzed using the comparative cycle-threshold (CT) method with the reference gene Eps8l1. The relative expression of the targeted gene was calculated as normalized to the control (wild type).
The RT-PCR products of Kcnma1 (BKα) were separated with 4% agarose gel (Bioline) stained with red safe (iNtRON Biotechnology), run at 120 V, and visualized with the Gel Doc 2000 gel documentation system (Bio-Rad Lab. AG, Reinach, Switzerland). Actb was used as a reference.
The RT-PCR products of Kcnma1 (BKα) were separated with 4% agarose gel (Bioline) stained with red safe (iNtRON Biotechnology), run at 120 V, and visualized with the Gel Doc 2000 gel documentation system (Bio-Rad Lab. AG, Reinach, Switzerland). Actb was used as a reference.
8
RT-PCR Assay for SARS-CoV-2 S Segment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers for RT-PCR (Forward: TCTGCTGGTGATGATGGATTAAA, Reverse: CATCTCACTTTTGTTTCTTCCTCTCA) were designed using Primer Express 3.0 (Applied Biosystems) based on the NZV S segment. RT-PCR assays were conducted in 25-µl reactions using a SensiFAST™ Probe Lo-ROX One-Step Kit (Cat# BIO-78005, BIOLINE) as follows: 5 µl of the purified RNA were added to 20 µl of reaction mix composed of 12.5 µl of 2 × SensiFAST™ Probe One-Step mix, 1.25 µl of molecular-grade H2O, 2.75 µl of the forward and reverse primers (at final concentration of 0.55 µM), 0.5 µl of RiboSafe RNase Inhibitor (provided with the kit) and 0.25 µl of reverse transcriptase. The RT-PCR thermal cycle was as follows: 48 °C for 20 min, 95 °C for 2 min and 45 cycles of 94 °C for 15 sec and 60 °C for 35 sec. Fifteen microliters of each RT-PCR reaction was mixed with 3 µl of 6 × Gel Loading Dye (Cat# B7025S, New England BioLabs) and subjected to 2%-agarose/ethidium bromide gel electrophoresis. The agarose gel was then visualized under UV light using a Bio-Rad Gel Doc 2000 gel documentation system. A 50-bp DNA ladder (Cat# N3236L, New England Biolabs) was used for RT-PCR product size determination.
9
Intracellular Signaling Array Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate the intracellular signaling activities, the PathScan Intracellular Signaling Array Kit (Cell Signaling Technology, Danvers, MA, USA) was used to assess the activities of components of several key signaling pathways, including the insulin signaling pathway and the apoptosis pathway.
First, the whole protein lysates of K562 cells were prepared using lysis buffer in the kit and then placed onto the membrane window of the antibody array slide. The lysate-treated slide was incubated overnight at 4°C on an orbital shaker. Then, the whole slide was washed with wash buffer (1×) and incubated on the orbital shaker for 5 minutes (20°C). Then, each of the 18 wells was added to the Detection Antibody Cocktail (1×) and incubated for 1 hour (20°C) on an orbital shaker. Next, the slide was incubated for 30 minutes with HRP-linked Streptavidin (1×) after washing three times. Finally, the slide was treated with Lumi Glo and peroxide and delivered to a GEL-DOC 2000 Gel Documentation System (Bio-Rad Laboratories Inc.) for taking pictures. The Quantity One software (Bio-Rad Laboratories Inc.) was used for assessing the intensity of bands. The following day, the antibody membrane was incubated with 1× HRP-linked Streptavidin and visualized with Lumi Glo and peroxide. Images were taken using the Bio-Rad gel documentation system.
First, the whole protein lysates of K562 cells were prepared using lysis buffer in the kit and then placed onto the membrane window of the antibody array slide. The lysate-treated slide was incubated overnight at 4°C on an orbital shaker. Then, the whole slide was washed with wash buffer (1×) and incubated on the orbital shaker for 5 minutes (20°C). Then, each of the 18 wells was added to the Detection Antibody Cocktail (1×) and incubated for 1 hour (20°C) on an orbital shaker. Next, the slide was incubated for 30 minutes with HRP-linked Streptavidin (1×) after washing three times. Finally, the slide was treated with Lumi Glo and peroxide and delivered to a GEL-DOC 2000 Gel Documentation System (Bio-Rad Laboratories Inc.) for taking pictures. The Quantity One software (Bio-Rad Laboratories Inc.) was used for assessing the intensity of bands. The following day, the antibody membrane was incubated with 1× HRP-linked Streptavidin and visualized with Lumi Glo and peroxide. Images were taken using the Bio-Rad gel documentation system.
10
Multiplex Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of adipogenic, myogenic, osteogenic and neurotrophins genes was analyzed by reverse transcriptase-PCR (RT-PCR). Thirty nanogram of RNA were reverse transcribed and amplified using Qiagen One Step RT-PCR Kit (Qiagen, Hilden, Germany) and iCycler iQ™ (Bio-Rad Laboratories Inc., CA, USA). RT-PCR products were electrophoresed on a 2% agarose gel (Invitrogen Life Technologies) stained with GelRed™ (Biotium Inc., CA, USA) and visualized using a UV transilluminator Gel Doc 2000 Gel Documentation System (Bio-Rad Laboratories).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!