18 well glass bottom chamber slides

In vitro phase separation assays were performed at 25°C. Unlabeled N protein was mixed with Cy5-labeled protein (linked to an engineered N-terminal cysteine using maleimide linkage) at 1:10 ratio, then mixed with each sdAb at 1:1 ratio. Phase separation of 40 μM N protein (in 5 mM HEPES pH 7.5, 160 mM KCl) was induced by adding to a pre-mixture of three times volumes of UTR265 RNA (13.3 ng/μl in 5 mM HEPES pH 7.5). Samples were mixed in protein LoBind tubes (Eppendorf, 022431064) and then immediately transferred onto 18-well glass-bottom chamber slides (iBidi, 81817). Condensates were imaged after 40 min when the phase separation particles are stable. Images were taken on a CQ1 confocal quantitative image microscope (Yokogawa) with 20x-PH objective. For quantitation, condensates were identified by particle analysis in CQ1 analysis software, then the total fluorescence inside condensates and the total volume of condensates were calculated and divided by the total fluorescence in the field or the total volume of the field to yield a percentage value.
>UTR265 (nt 1-265 of SARS-CoV-2 genome) AUUAAAGGUUUAUACCUUCCCAGGUAACAAACCAACCAACUUUCGAUCUCUUGUAGAUCUGUUCUCUAAACGAACUUUAAAAUCUGUGUGGCUGUCACUCGGCUGCAUGCUUAGUGCACUCACGCAGUAUAAUUAAUAACUAAUUACUGUCGUUGACAGGACACGAGUAACUCGUCUAUCUUCUGCAGGCUGCUUACGGUUUCGUCCGUGUUGCAGCCGAUCAUCAGCACAUCUAGGUUUCGUCCGGGUGUGACCGAAAGGUAAG.