Enzymatic shearing kit

Chromatin immunoprecipitation (ChIP) was performed using the ChIP‐IT Express kit (Active Motif) according to the manufacturer's instructions. A total of 10⁷ cells were fixed with 1% formaldehyde and lysed to release chromatin. Chromatin was then enzymatically sheared to obtain chromatin of approximately 100–500 bp using the Active Motif Enzymatic Shearing Kit. Sheared chromatin was immunoprecipitated with antibodies against 5‐mC (Active Motiv, no. 61479). IgG was used as mock control. DNA released from reverse crosslinking was purified prior to qPCR. Starting chromatin was used as input. The level of DNA bound to selected proteins was quantified by SYBR‐Green qPCR using LightCycler^®96 (Roche, Basel, Switzerland). The primers for the COMT gene were 5′‐GCCCATTCACACACACAGTC‐3′ for forward and 5′‐GTTTCATTCCATGCACGACA‐3′ for reverse. The qPCR parameters were 95 °C for 60 s, followed by 45 repeats of 95 °C for 15 s, and 60 °C for 60 s. The level of bound DNA sequences was calculated using the percentage input method (2−[Ct(ChIP)−Ct(Input)]×100, where C_t is the cycle threshold value) by calculating the qPCR signal relative to input sample.

The ChIP assay was performed with using a ChIP-IT Express Enzymatic kit (Active Motif) as previously described [29 (link)]. Briefly, 1 × 10⁷ cells were cross-linked with 1% formaldehyde for 10 min at room temperature and quenched by adding glycine. To harvest chromatin-DNA complexes, the cell lysate was treated with an enzymatic shearing kit (Active Motif), according to the manufacturer's specifications. For immunoprecipitation, 120 μg of chromatin-DNA complexes were incubated with Protein G magnetic beads linked to anti-SMAD4 antibody (10 μg, Cell Signaling Technology, Danvers, Massachusetts, USA), or anti-IgG antibody (10 μg, Active Motif). Eluates were used as templates for PCR. Equal amounts of anti-IgG or pre-immune chromatin-DNA complex were used as controls. The primer sets used for PCR amplification were: SNAI1: 5′-GCTGTCACACCCGGCACCAAG-3′ and 5′-GGCGGCTTGAAATGCCACGG-3′, SNAI2: 5′-ATGCGTGTGAAGTGCTTAGCATAGT-3′ and 5′-CACTCAGTGCCCAACAGTGTGT-3′, ZEB1: 5′-TTTCGGGAAGTTAAAATGTTTG-3′ and 5′-ATCCTGCTTCATCTGCCTGA-3′, ZEB2: 5′-TACGCCTGCGCTGTGACCTA-3′ and 5′-ACTCACTGGACCCGCCTCAG-3′, and TWIST: 5′-AGTCTCCTCCGACCGCTTCCTG-3′ and 5′-CTCCGTGCAGGCGGAAAGTTTGG-3′.