Rneasy protocol

The mesenteric arteries were dissected from the intestinal wall and placed in phosphate buffered saline at 4°C. Under an Olympus dissecting microscope, the fat and veins were removed from the vessels, and the tissue was snap frozen in a dry ice–methanol bath and transferred to a −80°C freezer until further use. Ceramic microbeads were used to homogenize the vessels. Total RNA was extracted according to the RNeasy protocol (Bio‐Rad, Hercules, CA). High‐capacity cDNA reverse transcription (Applied Biosystems, Foster City, CA) was used to reverse transcribe the purified RNA (1 µg). Real‐time polymerase chain reaction was used to quantitate AT₁R cDNA with an ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, CA). The polymerase chain reaction reaction mixture consisted of RNase‐free water, SYBR green supermix and 300 nmol/L specific primers as previously described¹⁴: angiotensin type 1 receptor (AT₁R)—F: 5′‐CTC AAG CCT GTC TAC GAA AAT GAG‐3′; R: 5′‐TAG ATC CTG AGG CAG GGT GAA T‐3′; and, beta‐actin—F: 5′‐CCCATCTATGAGGGTTACGC‐3′, R: 5′TTTAATGTCACGCACGATTTC‐3′. Standard curves were used to calculate the AT₁R cDNA in mesenteric arteries.