Log In Sign up
The largest database of trusted experimental protocols

Plko 1 trc control vector

Manufactured by Thermo Fisher Scientific
Visit Supplier

The PLKO.1-TRC-control vector is a lentiviral vector used as a control for gene knockdown experiments. It contains the puromycin resistance gene for selection of transduced cells and a non-targeting shRNA sequence.

Automatically generated - may contain errors

Lab products found in correlation

Polybrene, by Merck Group (1 mentions)

Spelling variants of this product

PLKO.1 (46 citations) PLKO.1 vector (27 citations) Control vector (9 citations) PLKO vectors (8 citations)

2 protocols using plko 1 trc control vector

1

Lentiviral shRNA knockdown of EAG2 and KCNT2

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human pLKO.1 lentiviral shRNA target gene set against EAG2, KCNT2 and pLKO.1-TRC-control vector were obtained from Open Biosystems. The concentrated lentiviral particles were generated by the UCSF Viracore. Virus infections were performed within antibiotics-free culture medium for 24 hours. Final concentration of 10 μg/ml polybrene (Millipore) was added into the culture medium to enhance virus infection efficiency. The specific sequence of the EAG2 shRNAs is previously reported24 (link). KCNT2 shRNA mature antisense sequences are: #1: ATCACCACATAATAATCCTGG; #2: ATAGGTCTTGATCTTTAAGGG; #3: ATAAGGTGGGTAACCTTTAGC.
Huang X., He Y., Dubuc A.M., Hashizume R., Zhang W., Reimand J., Yang H., Wang T.A., Stehbens S.J., Younger S., Barshow S., Zhu S., Cooper M.K., Peacock J., Ramaswamy V., Garzia L., Wu X., Remke M., Forester C.M., Kim C.C., Weiss W.A., James C.D., Shuman M.A., Bader G.D., Mueller S., Taylor M.D., Jan Y.N, & Jan L.Y. (2015). EAG2 potassium channel with evolutionarily conserved function as a brain tumor target. Nature neuroscience, 18(9), 1236-1246.
+ Open protocol
+ Expand
2

CLIC1 and EAG2 Knockdown Lentiviral Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human pLKO.1 lentiviral shRNA target gene set against CLIC1 and pLKO.1-TRC-control vector were obtained from Open Biosystems. Virus infections were performed within antibiotics-free culture medium for 24 h. The CLIC1 shRNA mature antisense sequences are 5′-TTC​AGC​ACT​GGT​TTC​ATC​CAC-3′ (#1) and 5′-TCA​ACG​GTG​GTA​ACA​TTG​AAG-3′ (#2). The EAG2 shRNA mature antisense sequence is 5′-ATA​TTA​TTC​TTG​AGT​CGC​AGC-3′.
Francisco M.A., Wanggou S., Fan J.J., Dong W., Chen X., Momin A., Abeysundara N., Min H.K., Chan J., McAdam R., Sia M., Pusong R.J., Liu S., Patel N., Ramaswamy V., Kijima N., Wang L.Y., Song Y., Kafri R., Taylor M.D., Li X, & Huang X. (2020). Chloride intracellular channel 1 cooperates with potassium channel EAG2 to promote medulloblastoma growth. The Journal of Experimental Medicine, 217(5), e20190971.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!