Fastsybr mixture

The total RNA was extracted at 2 µg and then reversely transcribed to cDNA template by the M-MuLV cDNA Synthesis Kit (Sangon Biotech, China). RT-qPCR was performed on a Smart Cycler using FastSYBR Mixture (Sangon Biotech, China). The relative EIF3D mRNA levels were normalized to GAPDH levels by using 2− deltaCT method. The sequences of primer are listed as follow: EIF3D (Forward) 5ʹ-CTGGAGGAGGGCAAATACCT – −3ʹ, and (Reverse) 5ʹ- CTCGGTGGAAGGACAAACTC −3ʹ; GAPDH (Forward) 5ʹ-TGATGACATCAAGAAGGTGGTGAAG −3ʹ, and (Reverse) 5ʹ-TCCTTGGAGGCCATGTGGGCCAT −3ʹ.

The total RNA was extracted using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) and 2 µg was reversely transcribed to cDNA template by the M-MuLV cDNA Synthesis Kit (Sangon, China). RT-qPCR was performed on a Smart Cycler using FastSYBR Mixture (Sangon, China). Primer sequences are listed as follow: TSPAN1 (Forward) 5ʹ-CCAATAAGCTTATGCAGCTTCAATTAAGA −3ʹ, and (Reverse) 5ʹ – CCAATGAATTCTTGTAGATTGCAGTACAGATACATG-3ʹ; GAPDH (Forward) 5ʹ-TGATGACATCAAGAAGGTGGTGAAG −3ʹ, and (Reverse) 5ʹ-TCCTTGGAGGCCATGTGGGCCAT −3ʹ. The primers were checked on primer 5.0 software. The following thermocycling conditions were used: Initial denaturation at 95°C for 3 min; followed by 30 cycles of denaturation at 95°C for 30 sec, annealing at 58°C for 30 sec and extension at 72°C for 30 sec. The 2-ΔΔCq method was used to quantify the results.