ChIP assays were conducted using the SimpleChIP® Enzymatic Chromatin IP kit according to the manufacturer's instructions (Cell Signaling Technology). Briefly, chromatins that had been previously prepared and digested was incubated with 2 μg of LEF-1 antibody (Santa Cruz Biotechnology) or with normal anti-IgG rabbit antibody (negative control). Then, the DNA was purified, and RT-qPCR assays were performed using the specific primers for each putative BMP4 binding site listed above. The reactions were performed in a Rotor-Gene 6000 thermocycler (Qiagen) using the following program: 95°C for 10 min, followed by 40 cycles at 95°C for 20s and 60°C for 30s with a final extension at 72°C for 30s. Changes in LEF1 binding to DNA were calculated in relation to that of the IgG-precipitated control, normalized to the input.
Lef 1 antibody
Manufactured by Santa Cruz Biotechnology
The LEF-1 antibody is a research-use only product that can be used to detect the presence of the lymphoid enhancer-binding factor 1 (LEF-1) protein. LEF-1 is a transcription factor that plays a role in the Wnt signaling pathway and is involved in cellular processes such as cell differentiation and proliferation. The antibody can be used in various applications, such as Western blotting, immunohistochemistry, and immunocytochemistry, to identify and analyze the expression of LEF-1 in biological samples.
Automatically generated - may contain errors
2 protocols using lef 1 antibody
1
LEF1 Binding to BMP4 Regulatory Regions
2
ChIP-qPCR Analysis of Transcription Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) was carried out using EZ ChIP kit (Millipore) following the manufacturer's protocol. Briefly, the cells were formaldehyde crosslinked and the lysates were shared by ultrasonication and cleared by centrifugation and diluted in ChIP dilution buffer. IP complexes were immunoprecipitated with LEF1 antibody (Santa Cruz), normal Goat IgG (negative control) and RNA pol II (positive control). Crosslinks were reserved by incubating chromatin at 65°C overnight and enriched DNA was amplified by PCR and primers indicated below.
CD44 promoter forward, 5′ – CTGCGTTTGATTTCCAAACA – 3′ and
CD44 promoter reverse, 5′ – CCTACCCAGCAGATCTTAAAGAGAGG – 3′,
YKL40 promoter forward, 5′ – CTGTTCACCCCTCCCCTAACACT – 3′
YKL40 promoter reverse, 5′ – GGCTGAAAATCTGTCTATTCTTCTG – 3′.
CD44 promoter forward, 5′ – CTGCGTTTGATTTCCAAACA – 3′ and
CD44 promoter reverse, 5′ – CCTACCCAGCAGATCTTAAAGAGAGG – 3′,
YKL40 promoter forward, 5′ – CTGTTCACCCCTCCCCTAACACT – 3′
YKL40 promoter reverse, 5′ – GGCTGAAAATCTGTCTATTCTTCTG – 3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!