Loopamp real time turbidimeter la 500

In this study, the optimal temperature of the C. albicans-LAMP assay was confirmed by setting the different reaction temperatures (61–68°C, with 1°C intervals) and using C. albicans reference strain (ATCC10231) template DNA (10 pg/μl). Amplification mixtures containing 1 μl of C. tropicalis and K. pneumoniae template were used as NC, and 1 μl of DW was used as a blank control. The assay was performed according to the standard LAMP assay and was monitored using the Loopamp Realtime Turbidimeter LA-500 (Eiken Chemical Co., Ltd., Japan). Moreover, the threshold value (turbidity) was 0.1, and turbidity of >0.1 was considered positive amplification (Li et al., 2019 (link)).

DNA amplification was performed by LAMP, which targeted a fragment of the hly gene of L. monocytogenes. To this end, the assay described by Garrido-Maestu et al. was selected [41 (link)]. The reactions were performed in a final volume of 25 µL composed of 15 µL of turbidometric master mix (OptiGene, Horsham, UK), 1000 nM FIP/ BIP primers, 200 nM F3/ B3 primers and 600 nM LB. Additionally, each reaction contained 4 µL of 1NAT:GSH:lowTPEG-AuNPs and 4 µL of template DNA. The amplification was performed in a Loopamp Realtime Turbidimeter (LA-500, Eiken Chemical Co., Ltd., Tokyo, Japan) at 62 °C for 60 min. DNA extracted from L. monocytogenes WDCM 00021 was selected as positive control. Its concentration was determined with a NanoDrop 2000c (Thermo Fisher Scientific Inc., Waltham, MA, USA). The sequences of the primers selected were: hly-F3: TGTGTTTGAGCTAGTGGTTTGG, hly-B3: CCCATTAGGCGGAAAAGCATAT, hly-FIP: GCAGCGCTCTCTATACCAGGTACAttttAATG-TCCATGTTATGTCTCCGTTA, hly-BIP: AGGTTTGTTGTGTCAGGTAGAGCGttttCGCTTAAT-AACTGGAATAAGCCAA and hly-LB: CATCCATTGTTTTGTAGTTACAGAG.

The SYBR green I LAMP assay was conducted using the primers targeted on the 18S rRNA gene that has been described by Lau et al. [8 (link)]. The LAMP assay was performed in a 25-µL reaction mixture that consisted of 5.7 µL distilled water, 2.5 µL of 10X isothermal amplification buffer, 5.5 µL of MgSO₄, 2.7 µL of dNTPs (New England Biolabs, Ipswich, Massachusetts, United States), 4 µL of betaine (Sigma-Aldrich, St. Louis, Missouri, United States), 40 pmol of FIP and BIP each, 10 pmol of FLP and BLP each, 5 pmol of F3 and B3 each, and 1 µL of Bst 2.0 WarmStart DNA polymerase (New England Biolabs, Ipswich, Massachusetts, United States). The template consisted of 4 µL of extracted DNA from blood spots. One µL of diluted SYBR green I (Sigma-Aldrich, St. Louis, Missouri, United States) was placed on the inner side of the tube. The closed-tube was then incubated at 65 °C in a Loopamp Real-Time Turbidimeter LA 500 (Eiken, Taiko-ku, Japan) for 30 min. At the end of the reaction, the tubes were cooled to room temperature and briefly spun to allow mixing of SYBR green I with the amplified products. The colour changes were visualized by the naked eyes. The kappa (k) statistics was applied to calculate the agreement between the results observed by the real-time turbidity meter and the colour changes.