Log In Sign up
The largest database of trusted experimental protocols

Plko 1

Manufactured by Addgene
Visit Supplier
Sourced in United States, China

The PLKO.1 is a plasmid vector that can be used for the expression of shRNA in mammalian cells. It contains a human U6 promoter for shRNA expression and a puromycin resistance gene for selection.

Automatically generated - may contain errors

Lab products found in correlation

Pmd2 g, by Addgene (39 mentions) Pspax2, by Addgene (37 mentions) Polybrene, by Merck Group (17 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (17 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (16 mentions) Puromycin, by Merck Group (13 mentions) Prsv rev, by Addgene (9 mentions) Plvx puro, by Takara Bio (9 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (9 mentions) Puromycin, by Thermo Fisher Scientific (8 mentions) Pmdlg prre, by Addgene (7 mentions) Lipofectamine 2000 reagent, by Thermo Fisher Scientific (6 mentions) Pcmv vsv g, by Addgene (4 mentions) Plvx puro vector, by Takara Bio (4 mentions) Peg 6000, by Merck Group (4 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (4 mentions) Pcdh cmv mcs ef1 puro, by System Biosciences (4 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (3 mentions) Pcdh ef1 mcs ires puro, by System Biosciences (3 mentions) Puromycin, by Yeasen (3 mentions)

208 protocols using plko 1

1

Establishing Stable ESCC Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human ESCC cell lines, KYSE150, KYSE30, KYSE410, KYSE450, YSE2 and esophageal epithelial cell-SHEE, were originally maintained in Roswell Park Memorial Institute (RPMI) 1640 medium supplemented with 10% fetal bovine serum (FBS), penicillin (100 U/mL), and streptomycin (100 μg/mL).
For establishing stable DGKα knockdown ESCC cell lines, KYSE30, KYSE410, and KYSE150 cells were transfected with the pLKO.1 (Addgene, Watertown, MA, USA) and pLKO.1 vector expressing small hairpin (sh) RNA for DGKα knockdown (pLKO.1-shDGKα). Transfected cells were selected by 0.5 μg/mL puromycin. The DGKα shRNA sequences used in present study was according to our previous study5 (link). ESCC cells stably expressing Flag-DGKα D435E mutant were generated by transfection of pcDNA3.1/Flag-DGKα D435E plasmid into the indicated ESCC cells and then cultured for 10–14 days with 400 μg/mL G418. Point mutation on DGKα was obtained using Phusion™ high-fidelity DNA polymerase (Thermo Fisher; Cat# F530L, Waltham, MA, USA). Mutating oligonucleotides were: DGKα D435E CTAGAATCCAGCCTACTGTGCCTTCTCCACCACACACCAAAATCCG and CGGATTTTGGTGTGTGGTGGAGAAGGCACAGTAGGCTGGATTCTAG.
Chen J., Wang Y., Zhao D., Zhang L., Zhang W., Fan J., Li J, & Zhan Q. (2020). Chrysin serves as a novel inhibitor of DGKα/FAK interaction to suppress the malignancy of esophageal squamous cell carcinoma (ESCC). Acta Pharmaceutica Sinica. B, 11(1), 143-155.
+ Open protocol
+ Expand
2

TERC Knockdown in A549 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNA sequences are listed in Table S2. siRNA transfection was performed with Lipofectamine 3000 Transfection Reagent (Thermo Fisher Scientific-Invitrogen) according to the manufacturer’s instruction.
The knockdown plasmids were derived from pLKO.1 (addgene). pLKO.1 was cut open with AgeI and EcoRI, re-ligated with annealed oligos containing short hairpin sequences to knock down TERC (Table S2), transformed into Stbl3 competent cells and confirmed by sequencing.
To establish TERC knockdown (TERC-sh) and control stable cells, pLKO.1-TERC-sh or pLKO.1 together with psPAX2 (addgene) and pMD2.G (addgene) plasmids were co-transfected into HEK-293T cells. The virus-containing media were harvested 48 hours after transfection, filtered with a 0.22 μm unit, and added to A549 cells that were approximately 70% confluent and cultured in fresh media with 8 μg/mL Polybrene (Santa Cruz). 24 hours after infection, media were changed and 2 μg/mL puromycin was added to select for positive clones for at least one week.
Sun H., Li X., Long Q., Wang X., Zhu W., Chen E., Zhou W., Yang H., Huang C., Deng W, & Chen M. (2024). TERC promotes non-small cell lung cancer progression by facilitating the nuclear localization of TERT. iScience, 27(6), 109869.
+ Open protocol
+ Expand
3

Lentiviral Transduction of Banf1 shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
ShRNA sequences (Banf1-1 shRNA: GGGAATGGCTGAAA, Banf1-2 shRNA GAATGGCTGAAAGACACTT) were cloned into pLKO.1 (Addgene: 10878) as per Addgene referenced protocol (pLKO.1 TRC cloning).
The day before transfection (Day 1), 293FT cells were plated into a T75 tissue culture plate so that they would be 90–95% confluent on the day of transfection. For each transfection reaction Fugene HD complexes were generated as follows: 36 μl Fugene + 1.5 ml OptiMEM per reaction then added 0.5 μg pTAT, 2.8 μg pHEF-VSV-G and 7.1 μg pNHP + 3.5 μg of Lentiviral Plasmid (pLKO.1 containing shRNA) per reaction. Complexes were incubated for 15 min and added to each plate of cells. Incubate the cells overnight at 37 °C in a humidified 5% CO2 incubator. The next day media was replaced. Virus was harvested after 48/72 h by collecting the condition media and centrifuging the 293FT cells.
To transform cells: Polybrene (2 μg/mL) was added to plated U2OS cells, followed by the addition of 1 mL of virus containing media (T25). Cells were cultured for 48–72 h for optimal depletion of Banf1.
Bolderson E., Burgess J.T., Li J., Gandhi N.S., Boucher D., Croft L.V., Beard S., Plowman J.J., Suraweera A., Adams M.N., Naqi A., Zhang S.D., Sinclair D.A., O’Byrne K.J, & Richard D.J. (2019). Barrier-to-autointegration factor 1 (Banf1) regulates poly [ADP-ribose] polymerase 1 (PARP1) activity following oxidative DNA damage. Nature Communications, 10, 5501.
+ Open protocol
+ Expand
4

Silencing RECQ1 by shRNA and siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
shRNA-mediated down-regulation was achieved by cloning the sequence targeting RECQ1 (5′-GAGCTTATGTTACCAGTTA-3′) into the pLKO.1 (plasmid #10878; Addgene) lentiviral shRNA expression vector. Lentiviral particles were generated by transient cotransfection of pLKO.1 and the packaging plasmids psPAX2 (plasmid #12260; Addgene) and pM2D.G (plasmid #12259; Addgene) into HEK293T cells. Viral supernatants were filtered through a 0.45-µM filter and transduced on U2OS cells for 24 h followed by selection with 8 µg/ml puromycin for 3 d. Control transductions were performed using the pLKO.1 vector expressing a shRNA targeting Luciferase (5′-ACGCTGAGTACTTCGAAATGT-3′). For siRNA experiments, cells were transfected with the indicated siRNA using RNAiMAX (Invitrogen) according to manufacturer’s instruction. The experiments were performed 24 or 72 h after transfection. Purchased sequences were as follows: Luc siRNA (40 nM; 5′-CGUACGCGGAAUACUUCGA-3′), RAD51 #1 siRNA (40 nM; 5′-GAGCUUGACAAACUACUUC-3′), and RAD51 #2 siRNA (40 nM: 5′-GACUGCCAGGAUAAAGCUU-3′).
Zellweger R., Dalcher D., Mutreja K., Berti M., Schmid J.A., Herrador R., Vindigni A, & Lopes M. (2015). Rad51-mediated replication fork reversal is a global response to genotoxic treatments in human cells. The Journal of Cell Biology, 208(5), 563-579.
+ Open protocol
+ Expand
5

SUMO1 Overexpression and Silencing in HTEC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human SUMO1 cDNA was cloned into the lentiviral core plasmid pLVX-Puro (Clontech, Palo Alto, CA, USA) to construct the recombinant plasmid pLVX-Puro-SUMO1. The SUMO1 targeting siRNA sequences (targeting sequence: siSUMO1-1 (238-256): 5'-GCAGTGAGATTCACTTCAA-3'; siSUMO1-2 (395-413): 5'-GGAAGAAGATGTGATTGAA-3'; siSUMO1-3 (727-745): 5'-GGCTTGTGGTGATAAATAA-3' were cloned into lentiviral core plasmid PLKO.1 (Addgene, Cambridge, MA, USA) to construct the recombinant plasmid PLKO.1-shARHGAP18. HTEC cells were pre-cultured in serum-free medium and co-transfected with liposome-mediated recombinant plasmid pLVX-Puro-SUMO1 and packaging plasmids psPAX2 and pMD2G.
Lin Y., Wang M., Xiao Z, & Jiang Z. (2021). Hypoxia activates SUMO-1-HIF-1α signaling pathway to upregulate pro-inflammatory cytokines and permeability in human tonsil epithelial cells. Life sciences, 276.
+ Open protocol
+ Expand
6

Retroviral Expression of Tag-RFP-T-SH3BP5 Fusions

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Tag-RFP-T-SH3BP5 and SH3BP5L fusions were subcloned into the retroviral plasmid pMXs-IRES-Puro (Clontech) using the NotI/EcoRI restriction sites and InFusion HD cloning kit (Clontech).
sgRNA sequences targeting dog SH3BP5, SH3BP5L, TNKS, TNKS2, and RNF146 were selected from the CRISPOR design tool (http://www.crispor.tefor.net) by entering the cDNA sequence of specific exons (Haeussler et al., 2016 (link)). Guide sequences were cloned into the plasmid pLCKO using BfuAI and NsiI sites (Table 1).
Two shRNAs against dog Rab11a were obtained from the RNAi consortium. Scrambled control (shSCM) hairpin was cloned into pLKO.1 (Addgene #10878) by annealing oligos into pLKO.1 digested with EcoRI and AgeI (Table 2).
Chandrakumar A.A., Coyaud É., Marshall C.B., Ikura M., Raught B, & Rottapel R. (2021). Tankyrase regulates epithelial lumen formation via suppression of Rab11 GEFs. The Journal of Cell Biology, 220(7), e202008037.
+ Open protocol
+ Expand
7

SUMO1 Overexpression and Silencing in HTEC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human SUMO1 cDNA was cloned into the lentiviral core plasmid pLVX-Puro (Clontech, Palo Alto, CA, USA) to construct the recombinant plasmid pLVX-Puro-SUMO1. The SUMO1 targeting siRNA sequences (targeting sequence: siSUMO1-1 (238-256): 5'-GCAGTGAGATTCACTTCAA-3'; siSUMO1-2 (395-413): 5'-GGAAGAAGATGTGATTGAA-3'; siSUMO1-3 (727-745): 5'-GGCTTGTGGTGATAAATAA-3' were cloned into lentiviral core plasmid PLKO.1 (Addgene, Cambridge, MA, USA) to construct the recombinant plasmid PLKO.1-shARHGAP18. HTEC cells were pre-cultured in serum-free medium and co-transfected with liposome-mediated recombinant plasmid pLVX-Puro-SUMO1 and packaging plasmids psPAX2 and pMD2G.
Lin Y., Wang M., Xiao Z., & Jiang Z. (2021). Hypoxia Activates SUMO-1-HIF-1α Signaling Pathway to Upregulate Pro-inflammatory Cytokines and Permeability in Human Tonsil Epithelial Cells.
+ Open protocol
+ Expand
8

Exo70, Ubiquitin, and shRNA Lentiviral Construct Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human Exo70 was Flag, mCherry, or GFP tagged by PCR and subcloned into pCMV10 (RRID: Addgene_51888) or pLV (RRID: Addgene_85140) vector. Ubiquitin (Ub) was Myc-tagged by PCR and subcloned into pcDNA3.0 (RRID: Addgene_12452) vector. shRNA were synthesized and cloned into pLKO.1 (RRID: Addgene_52920) vector. The sequences of shRNAs were listed in Table S2. Lentiviruses were generated by transfecting 293T cells with pLKO.1 vector encoding shRNA or pLV vector encoding Exo70, together with package vectors pMDL, pVSVG, and pRSV-Rev (RRID: Addgene_12253). Viruses were collected and infected cells. Stable cell lines were established by selection of 2 μg/mL puromycin.
Zhao Y., Hong X., Chen X., Hu C., Lu W., Xie B., Zhong L., Zhang W., Cao H., Chen B., Liu Q., Zhan Y., Xiao L, & Hu T. (2021). Deregulation of Exo70 Facilitates Innate and Acquired Cisplatin Resistance in Epithelial Ovarian Cancer by Promoting Cisplatin Efflux. Cancers, 13(14), 3467.
+ Open protocol
+ Expand
9

Lentiviral Overexpression and Knockdown of TUSC8

Check if the same lab product or an alternative is used in the 5 most similar protocols
For over-expression of TUSC8, the cDNA encoding TUSC8 was PCR amplified and subcloned into the lentiviral vector pLV (Addgene). Lentiviral preparations were generated by transient transfection of HEK293FT cells by using pLV-TUSC8, psPAX2 and pMD2.G plasmids. For knock-down of TUSC8, different TUSC8 shRNAs were inserted into lentiviral vector pLKO.1 (Addgene). Lentiviral preparations were generated the same as above. Lentiviruses were harvested at 48hrs after transfection and then filtered. Breast cancer cells were infected with above lentiviruses in the presence of 8μg/ml polybrene (Sigma-Aldrich). 48hrs after infection, the stable over-expression or knock-down cells were selected with puromycin (2μg/ml) for 1 week.
Zhao L., Zhou Y., Zhao Y., Li Q., Zhou J, & Mao Y. (2020). Long non-coding RNA TUSC8 inhibits breast cancer growth and metastasis via miR-190b-5p/MYLIP axis. Aging (Albany NY), 12(3), 2974-2991.
+ Open protocol
+ Expand
10

Generating CLASP2 shRNA and Overexpression Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively. Full-length human CLASP2α (National Center for Biotechnology Information reference sequence NM_015097.2) was PCR amplified from a full-length cDNA clone (IMAGE clone 9021646; BC140778) and subcloned into pCAG and pEGFP-C1 (Clontech). In addition, we obtained human full-length cDNA for CLASP2α, CLASP2-9S/A and CLASP2-8S/D (kind gift from Dr. Torsten Wittman, University of California San Francisco) and these were subcloned into the lentiviral vector pFUW and sequence verified. To generate truncated GFP-CLASP2 variants, we used full-length human CLASP2α as template and designed PCR primers at the regions of lowest complexity in order to optimally preserve domain structure, specifically 1–820, 821–1515, 1–270, 271–573, 574–820, 821–1200 and 1200–1515 amino acids were amplified by PCR and subcloned into pEGFP-C3 (Invitrogen).
Dillon G.M., Tyler W.A., Omuro K.C., Kambouris J., Tyminski C., Henry S., Haydar T.F., Beffert U, & Ho A. (2017). CLASP2 Links Reelin To The Cytoskeleton During Neocortical Development. Neuron, 93(6), 1344-1358.e5.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!