Ab21873

Formalin-fixed, paraffin-embedded blocks were sectioned into 3–5 µm slices for immunohistochemistry similarly as previously described [21 (link)]. Tissue microarray blocks were generated by removing a 2-mm core from each tumor. Anti-P-REX2a (ab121462, Abcam, Cambridge, MA, USA), anti-PTEN (ab21873, Abcam, Cambridge, UK), and anti-Vav1 (#PA5-21495, Thermo Fisher Scientific, Waltham, MA, USA) primary antibodies were used. Immunostaining was interpreted by three independent pathologists blinded to the clinical data. For P-REX2a, first, the samples that displayed cytoplasmic staining in more than 20% or 10% of cancer cells were determined as 2- or 1-plus, respectively. The 2-plus and 1-plus samples were considered positive, and the others, negative. Positive immunostaining of PTEN was observed in the cytoplasm or nuclei of tumour cells, and although the results of preliminary analyses were similar because PTEN localizes near the cell membrane, we considered cytoplasmic immunostaining to be positive. For Vav1, positive immunostaining was seen only in the cytoplasm of tumour cells, and the signal intensities were classified into 3 categories. For correlation analysis, positivity scores were applied, which included 2 categories for P-REX2a and 3 for Vav1.

The proteins were separated on 8%, 10 or 12% SDS-PAGE and then transferred to PVDF membrane (Merck Millipore). Samples belonging to a particular experiment were run in a same gel under same experimental conditions. The membrane was blocked in 5% skim milk for 2 h and then membranes were incubated overnight at 4°C with diluted (1:1000) primary antibodies against CBX7 (ab21873, abcam), N-Cadherin (#13116, CST), E-Cadherin (#1395, CST), Vimentin (#5741, CST), β-catenin (#8480, CST), AKT (#4685, CST), P-AKT (#4060, CST), GSK3β (#12456, CST), P-GSK3β (#5558, CST), ZEB1 (ab124512, abcam), MMP2 (#13132, CST), MMP9 (#13667, CST), DKK1 (#48367,CST), β-actin (AF0003, Beytime), GAPDH (AF0006, Beytime), H3 (#4499, CST) followed by incubation with a horseradish peroxidase-conjugated secondary antibody (1:2000, Santa Cruz Biotechnology, CA, USA) for 2 h. After washing with PBST, membranes were probed using SuperSignal^® Maximum Sensitivity Substrate (Thermo Fisher Scientific).

Chromatin samples obtained from cells and tissues were processed for chromatin immunoprecipitation as reported elsewhere [10] (link), [11] (link). Samples were subjected to immunoprecipitation with anti-CBX7 antibodies (ab21873, Abcam). Non related IgG were used as negative control of the immunoprecipitation. For qPCR 3 µl of 150 µl IP DNA was used and input DNA values were used to normalize the values from quantitative ChIP samples. Percent input was calculated according to the formula 2^ΔCt×3, where ΔCt is the difference between Ct_input and Ct_IP[10] (link). All quantitative data were derived from three independent experiments, and for each experiment qPCR was performed in triplicate. The sequences of the used primers are reported in Dataset S1. The promoter of human and mouse GAPDH gene was used as negative control of the CBX7 chromatin interaction [4] (link).

Chromatin immunoprecipitation experiments were performed as described previously (Pemberton et al., 2014). Immunoprecipitation of cross‐linked chromatin was conducted with CBX7 antibody (ab21873; Abcam, Cambridge, UK). After immunoprecipitation, DNA was extracted using the QIAquick PCR purification kit (Qiagen) and an aliquot amplified by real‐time qPCR using the following primers: hsa‐miR‐9‐1. PS1.1 (For: TTCTCGAATGCTGTGGACTG; Rev: AGAAGACGGTCTGGAAAGCA); PS3.1 (For: GCGCAGTGTATGGGGTTATT; Rev: GCGGGGTTGGTTGTTATCTT); PS4.1 (For: TGTCTGTGTGCCTGAAGAGG; Rev: GAATCCACCCTTTCCCAAAT). Hsa‐miR‐9‐2. PS1.2 (For: CTGCCAAATCATCAGCTTCA; Rev: TTCCTCCCATTTCAGTCTGG); PS2.2 (For: AGGCCGCTTTACAGGGTTAT; Rev: GCAAATACATTGCCCGAGTT); PS3.2 (For: GCCTCCCCTCTTGTCAAAGT; Rev: AGGCAAGACAGACCCTCAGA); PS4.2 (For: ATGACAGGGCCAATGAG; Rev: CCGAGGGCCAGTGACTATTA). To confirm target enrichment, each PCR product was evaluated first by standard end point PCR.