Cyclin b1

Cell culture essentials, including DMEM (Dulbecco’s Modified Eagle Medium), sodium pyruvate, non-essential amino acids, fetal bovine serum (FBS), and penicillin/streptomycin antibiotic mixture, were obtained from GIBCO (Grand Island, NY, USA). Diallyl trisulfide (DATS, purity > 98%) was procured from LKT Laboratories (St. Paul, MN, USA), and RNase A was sourced from Promega (Madison, WI, USA). Cyclin B1, Cdk1, pERK1/2, ERK1 antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA); the anti-beta actin antibody was purchased from Sigma (St. Louis, MO, USA); and the antibody against cleaved poly-(ADP-ribose)-polymerase (c-PARP), cleaved caspase-3, pAkt (Ser 473), Akt, γH2AX (Ser 139), were purchased from Cell Signaling Technology (Danvers, MA, USA). UMSCC-22A, UMSCC-22B, and Cal33 cells were a generous gift from Prof. Daniel E. Johnson (University of California, San Francisco, CA, USA). HNSCC cells were grown in DMEM and supplemented with 10% FBS, 100 µg/mL streptomycin, and 100 units/mL penicillin under standard culture conditions. Stock solution of DATS was prepared in dimethyl sulfoxide (DMSO).

HeLa, U2OS, 293T, H1299, HCT116, KLF14-WT and -KO MEF cells were maintained in DMEM with 10% fetal bovine serum. KLF2-10, KLF14-15 and KLF14 deletion mutants and Plk4 coding sequences were cloned into pCDNA 3.0 vector or pLVX-IRES (lentiviral expression vector) by standard cloning methods. The pLKO.1-shRNAs targeting KLF14 and Plk4 double-stranded oligo nucleotides are 5′- CCGGTCATCCAGATATGATCGAGTACTCGAGTACTCGATCATATCTGGATGATTTTTG -3′ (KLF14-Si-1), 5′- CCGGGCTGCACCAAAGCCTATTACACTCGAGTGTAATAGG CTTTGGTGCAGCTTTTTG -3′ (KLF14-Si-2), 5′- CCGGGACCTTATTCACCAGTTACTTCT CGAGAAGTAACTGGTGAATAAGGTCTTTTTG -3′ (human Plk4-Si) and 5′- CCGGCTACT CGGTAAAGGATCATTTCTCGAGAAATGATCCTTTACCGAGTAGTTTTTG -3′ (mouse Plk4-Si), respectively (target sequence underlined). Ataxia telangiectasia mutated inhibitor (caffeine), caspase inhibitor (Z-VAD-Fmk) and DNA damage reagent (MNNG) were obtained from Sigma. Antibodies used were KLF14 (SAB1304202, Sigma), Plk4 (12952-1-AP, Proteintech), cyclin B1 (Santa Cruz, sc-752), activated-caspase-3 (BS7004, Bioworld Technology), p-Histone H3 (BS4094, Bioworld Technology), p-Chk2 (BS4043, Bioworld Technology), Poly (ADP-ribose) polymerase (13371-1-AP, Proteintech), Chk2 (1C12, CST) and anti-γH2AX (ab26350, Abcam). Uncropped scans of typical blots using some of the antibodies are shown in Supplementary Fig. 6.

Imatinib was provided by Novartis Pharma AG (Basel, Switzerland). Antibodies for Western blotting, including caspase-9, caspase-3, cleaved caspase-3, PARP, phospho-c-Abl, phospho-Elk-1, phospho-cyclin-dependent kinase 1 (Cdk1) (Thr161), phospho-Cdk1 (Tyr15), phospho-ERK1/2, ERK1/2, phospho-Akt, Akt, phospho-STAT3, STAT3, Bcl-2, and Bcl-xL, were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies specific for c-Abl, multidrug resistance 1 (MDR1), α-tubulin, cyclin B1, Cdk1, Mcl-1, Bax, cytochrome c, and β-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). An antiphosphospecific MPM2 monoclonal antibody was purchased from Upstate Biotechnology (Lake Placid, NY, USA).

Western blot analysis was performed to determine the expression levels of various proteins in cells. Cells were treated with RY-2f or DMSO at different concentrations for 24 h. Cells were harvested, washed with cold 1 × PBS, and lysed with RIPA lysis buffer (Beyotime) for 30 min on ice, then centrifuged at 12,000 g for 15 min at 4°C. The total protein concentration was determined by BCA protein assay kit (Beyotime). Equal amounts (30 μg per load) of protein samples were subjected to SDS-PAGE electrophoresis and transferred on to polyvinylidene fluoride (PVDF) membranes (Millipore). The blots were blocked in 10% non-fat milk, and incubated with primary antibodies, followed by incubation with secondary antibodies conjugated with horseradish peroxidase (HRP). The protein bands were developed with the chemiluminescent reagents (Millipore). Antibodies to p21, Bcl-2, Bad, Bax, cyclin A, cyclin B1, CDK2, pAKT(Ser437), AKT, PI3K (p110 α), mTOR, PTEN were from Santa Cruz Biotechnology. The Antibody to cleaved-PARP-1 was purchased from Cell Signaling Technology. The antibody to β-Actin was purchased from Sigma-Aldrich.