Streptavidin agarose bead

Manufactured by Thermo Fisher Scientific

Sourced in United States, China

Streptavidin agarose beads are a type of affinity chromatography resin. They consist of streptavidin, a protein that binds to biotin, immobilized on agarose beads. These beads are commonly used for the purification and immobilization of biotinylated molecules.

Automatically generated - may contain errors

Lab products found in correlation

Biotin rna labeling mix, by Roche (119 mentions) Rneasy mini kit, by Qiagen (94 mentions) T7 rna polymerase, by Roche (56 mentions) Rnase free dnase 1, by Roche (55 mentions) Sulfo nhs lc biotin, by Thermo Fisher Scientific (17 mentions) T7 sp6 rna polymerase, by Roche (15 mentions) T7 rna polymerase, by Promega (11 mentions) Ez link sulfo nhs ss biotin, by Thermo Fisher Scientific (9 mentions) Sp6 rna polymerase, by Roche (8 mentions) Ne per nuclear and cytoplasmic extraction reagent, by Thermo Fisher Scientific (8 mentions) Rnase free dnase 1, by Promega (7 mentions) Dnase 1, by Takara Bio (7 mentions) Sulfo nhs biotin, by Thermo Fisher Scientific (6 mentions) Lysis buffer, by Thermo Fisher Scientific (6 mentions) Dulbecco phosphate buffered saline (dpbs), by Thermo Fisher Scientific (6 mentions) Biotin rna labelling mix, by Roche (6 mentions) Nitrocellulose membrane, by GE Healthcare (5 mentions) Ecl detection system, by GE Healthcare (5 mentions) Ez link sulfo nhs lc biotin, by Thermo Fisher Scientific (5 mentions) Complete protease inhibitor cocktail tablet, by Roche (5 mentions)

Close spelling variants of this product

Streptavidin-agarose bead suspension Agarose beads Streptavidin beads Streptavidin agarose Agarose

468 protocols using streptavidin agarose bead

Biotinylated Probe Purification and EMSA

Check if the same lab product or an alternative is used in the 5 most similar protocols

A 101-bp DNA fragment containing the κB1 and κB2 sites was amplified by PCR using biotinylated primers and purified using QIAEX II Gel Extraction System (QIAGEN). Purified probes (500 ng) were mixed with nuclear extract (50 μg) in 400 μl of binding buffer [60 mM KCl, 12 mM HEPES (pH 7.9), 4 mM Tris-HCl (pH 8.0), 1 mM EDTA, 1mM EGTA and 12% glycerol] containing 1.66 mM DTT, 0.06% BSA and 20 μg of poly(dI-dC) at 4°C for 2 h. If required, 100 pmol Sp1 binding oligo from CD40 promoter(22 (link)) and 500 pmol indicated competitor oligos were added. Then, pre-cleared streptavidin-agarose beads (life Technologies) were mixed with the DNA–nuclear extract mixture for 2 h. The streptavidin-agarose beads were then washed five times with 1 ml of binding buffer, and then 2x SDS sample buffer was added. The samples were analyzed by Immunoblotting. PCR primers used were as follows: κB forward: biotin-GAAACACC ACAGGTGGGACA; κB reverse, CACACCCATCAGCCGCCCACA; Gitr promoter forward, biotin-TGGGAGAGGCATGTAGGGGTTAGA; Gitr promoter reverse, TTTCCGGCAGACATCTGAGGT

Tone Y., Kidani Y., Ogawa C., Yamamoto K., Tsuda M., Peter C., Waldmann H, & Tone M. (2014). Gene expression in the Gitr locus is regulated by NF-κB and Foxp3 through an enhancer. Journal of immunology (Baltimore, Md. : 1950), 192(8), 3915-3924.

+ Open protocol

+ Expand

In vivo and in vitro Biotin pulldown assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

For in vivo Biotin pulldown assay, HeLa cells were treated with Biotin or Biotin-labeled 13-cis retinoic acid (5 μM, 24 h). Cells were starved for 2 h and harvested with M2 buffer. Streptavidin Agarose beads (Thermo, 20357) were added and incubated overnight at 4 °C. The beads were washed with M2 buffer six times. The indicated proteins were detected by Immunoblotting.
For in vitro Biotin pulldown assay, Biotin or Biotin-labeled 13-cis retinoic acid (0.5 μg) was preincubated with his-tagged STX17 (Proteintech, Ag12378) or SNAP29 (Proteintech, Ag24548) recombinant protein (1.5 μg) for 8 h at 4 °C. Then the mixture was incubated with Streptavidin Agarose beads (Thermo, 20357) overnight at 4 °C. The beads were washed five times with PBS (0.015% Triton X-100) and analyzed by Immunoblotting.

Li T., Lu D., Yao C., Li T., Dong H., Li Z., Xu G., Chen J., Zhang H., Yi X., Zhu H., Liu G., Wen K., Zhao H., Gao J., Zhang Y., Han Q., Li T., Zhang W., Zhao J., Li T., Bai Z., Song M., He X., Zhou T., Xia Q., Li A, & Pan X. (2022). Kansl1 haploinsufficiency impairs autophagosome-lysosome fusion and links autophagic dysfunction with Koolen-de Vries syndrome in mice. Nature Communications, 13, 931.

+ Open protocol

+ Expand

FOXO3a-Binding Site Affinity Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA fragment with a wild-type or mutant FOXO3a-binding site and with 5-biotin-labeled forward primers was used. The biotinylated probes were mixed with cell lysates transfected with TM-FOXO3a and DBM-FOXO3a, respectively. This was followed by the addition of streptavidin-agarose beads (Invitrogen) with incubation for an additional 1 h. The streptavidin-agarose beads were washed five times with the binding buffer and continued by the addition of SDS-sample buffer. This complex was subjected to immunoblotting with anti-HA antibody.

Das T.P., Suman S., Alatassi H., Ankem M.K, & Damodaran C. (2016). Inhibition of AKT promotes FOXO3a-dependent apoptosis in prostate cancer. Cell Death & Disease, 7(2), e2111-.

+ Open protocol

+ Expand

Arsenic-Biotin Conjugate: Protein Isolation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were treated with an arsenic-biotin conjugate (As-Biotin) (CAS Number: 212391-23-6, Toronto Research Chemicals, Inc) at a final concentration of 20 μM for 2 hrs. This compound has been previous used to isolated arsenic binding proteins as it will bind to thiol groups (6 (link), 8 (link), 37 (link), 38 (link)). After lysis in phospho-lysis buffer, 500 μg of protein was diluted in buffer and the arsenic-protein complexes were then isolated with streptavidin agarose beads by tumbling at 4°C overnight (Invitrogen Life Technologies). For recombinant protein, purified AMPKα1 subunit (Novus Biologicals) or the active holoenzyme containing AMPKα1/β1/γ1 (SignalChem) protein was incubated for 30 minutes with As-Biotin at 30°C. The arsenic-protein complex was then isolated with streptavidin agarose beads at 4°C for 1 hr (Invitrogen Life Technologies, Carlsbad, CA). The beads were washed 3 times with phospho-lysis buffer not containing Triton-X 100. The samples were then boiled for 5 min at 95 °C in 2x Laemmli sample buffer and subject to SDS-PAGE. Immunoblotting was performed as described above.

Beauchamp E.M., Kosciuczuk E.M., Serrano R., Nanavati D., Swindell E.P., Viollet B., O'Halloran T.V., Altman J.K, & Platanias L.C. (2014). Direct binding of arsenic trioxide to AMPK and generation of inhibitory effects on acute myeloid leukemia precursors. Molecular cancer therapeutics, 14(1), 202-212.

+ Open protocol

+ Expand

Investigating miR-503-5p Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

TSCC cells were transfected with miR-503-5p mimics and incubated for 48 h. Then, the cells were harvested and lysed. The biotin-labeled PART1 (Bio-PART1, probe sequence was shown in

Table S1

) was conjugated to streptavidin agarose beads (Invitrogen, USA). Cell lysate was mixed with Bio-PART1 or Bio-NC for 2 h, and then streptavidin agarose beads (Invitrogen, USA) were added and incubated for 1 h. The expression level of miR-503-5p in coprecipitated RNAs (

Table S2

) was determined by qRT-PCR as mentioned before.

Zhao X., Hong Y., Cheng Q, & Guo L. (2020). LncRNA PART1 Exerts Tumor-Suppressive Functions in Tongue Squamous Cell Carcinoma via miR-503-5p. OncoTargets and therapy, 13, 9977-9989.

+ Open protocol

+ Expand

Detection of lncRNA MEG3 and miR-9-5p interaction

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA pull-down assay was used to detect whether lncRNA MEG3 is relevant for miR-9-5p. In this assay, the biotin-labeled MEG3, as a probe, or random pull-down probe sequence, as negative control (NC), were reversely transcribed via Biotin RNA labeling mix (Roche Diagnostics, USA) and T7 RNA polymerase (Roche, Switzerland). Subsequently, the samples were processed by RNase-free DNase I (Roche) and then purified using the RNeasy Mini Kit (Qiagen, USA). Huh7 and SK-HEP-1 cell lines were lysed in RIPA buffer for 30 min and the lysates were mixed with biotin-labeled MEG3 followed by incubating for 1 h at 4°C. Subsequently, the reaction mixture was incubated with streptavidin agarose beads (Life Technologies, USA) for 1 h at room temperature. qRT-PCR was utilized to measure the co-precipitated RNAs.

Liu Z., Chen J.Y., Zhong Y., Xie L, & Li J.S. (2019). lncRNA MEG3 inhibits the growth of hepatocellular carcinoma cells by sponging miR-9-5p to upregulate SOX11. Brazilian Journal of Medical and Biological Research, 52(10), e8631.

+ Open protocol

+ Expand

Biotin-based RNA Labeling and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Biotin RNA Labeling Mix (Roche Molecular Systems, Inc., Hague Road, IN, United States) was used for biotin labeling of RNA, and later T7 RNA polymerase (Roche) was utilized for transcription in vitro. After purification, the protein lysates were adopted for cultivating biotinylated cells. Thereafter, streptavidin agarose beads (Life Technologies, Carlsbad, CA, United States) were utilized for treating cells for another 1 h under ambient temperature, followed by bead elution within Biotin Elution Buffer three times and boiling within SDS buffer. Later, we conducted qRT-PCR and WB assays for RNA and protein analyses, with IgG being the reference.

Yin Z., Shen H., Gu C.M., Zhang M.Q., Liu Z., Huang J., Zhu Y., Zhong Q., Huang Y., Wu F., Ou R., Zhang Q, & Liu S. (2021). MiRNA-142-3P and FUS can be Sponged by Long Noncoding RNA DUBR to Promote Cell Proliferation in Acute Myeloid Leukemia. Frontiers in Molecular Biosciences, 8, 754936.

+ Open protocol

+ Expand

LINC00662 and miR-16-5p Biotin Pulldown Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

LINC00662 biotin probe and LINC00662 no-biotin probe, as well as miR-16-5p biotin probe and miR-16-5p no-biotin probe, were synthesized by Sangon (Shanghai, China). The cell protein extracts from U2OS or SAOS‐2 were collected for incubation with the RNA or NC probes overnight. Then, the lysate was added with streptavidin agarose beads (Life Technologies) and incubated for another 1 h at room temperature. Next, these beads were boiled in SDS buffer and purified by RNeasy Mini Kit (Qiagen, USA). The purified RNA was detected by RT-qPCR.

Yu M., Lu W., Cao Z, & Xuan T. (2021). LncRNA LINC00662 Exerts an Oncogenic Effect on Osteosarcoma by the miR-16-5p/ITPR1 Axis. Journal of Oncology, 2021, 8493431.

+ Open protocol

+ Expand

Biotinylated RNA Protein Interactome

Check if the same lab product or an alternative is used in the 5 most similar protocols

Biotin‐labelled F63 was transcribed in vitro with the Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase (Roche) and then treated with RNase‐free DNase I (Roche) and 0.2 mol/L EDTA to stop the reaction. Biotinylated RNAs were mixed with streptavidin agarose beads (Life Technologies) at 4℃ overnight. Total cell lysates and RNase inhibitor were added to each binding reaction and incubated on ice for 1 hour. The RNA‐protein binding mixture was boiled in SDS buffer, and the eluted proteins were analysed by LC‐MS, which was performed by Luming Biotechnology.

Qin L., Zhong M., Adah D., Qin L., Chen X., Ma C., Fu Q., Zhu X., Li Z., Wang N, & Chen Y. (2020). A novel tumour suppressor lncRNA F630028O10Rik inhibits lung cancer angiogenesis by regulating miR‐223‐3p. Journal of Cellular and Molecular Medicine, 24(6), 3549-3559.

+ Open protocol

+ Expand

Biotin-labeled RNA Pull-down Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA pull-down assay was performed as described previously [14 (link)]. The pSPT19 plasmid containing sense or antisense CASC2 were constructed and purchased from GenePharma Company. Briefly, RNAs were biotin-labeled and in vitro transcribed. After purification, biotinylated RNAs were mixed and incubated with ESCC cell lysates. Streptavidin agarose beads (Life Technologies) were added to each binding reaction and incubated for 1 h. The beads were then boiled in sodium dodecyl sulfate (SDS) buffer. The eluted proteins were detected by western blot.

Sun K, & Zhang G. (2019). Long noncoding RNA CASC2 suppresses esophageal squamous cell carcinoma progression by increasing SOCS1 expression. Cell & Bioscience, 9, 90.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!