Exicyclertm 96

Total RNA was extracted by Direct-zol RNA Isolation Kit (Zymogen) and cDNA was synthesized by Sensifast cDNA synthesis kit (Bioline) as described by the manufacturer. Primers were synthesized by Macrogen as listed in Supplementary Table 4. RT-qPCR was performed with SensiFAST^TM SYBRQR No-ROX Kit (Bio- line) on Exicycler^TM 96 (Bioneer). qRT-PCR results were analyzed by ΔΔCt method for relative quantifications taking GAPDH or HPRT as internal controls.

Total DNA was extracted from B. subtilis, P. fragi, and E. coli using a bacterial genome DNA rapid extraction kit (B518225, Shanghai Bioengineering Co., Ltd., Shanghai, China) and quantified with an ultraviolet spectrophotometer (NanoDrop 2000, Thermo Scientific, Waltham, MA, USA). The mRNA levels of the genes of interest (Table 1) were quantified using qPCR analysis (ExicyclerTM 96, BIONEER, Daejeon, Republic of Korea) under the following conditions: 95 °C for 5 min, 95 °C for 10 s, 60 °C for 15 s, and 72 °C for 15 s, followed by 40 cycles of 72 °C for 90 s, 40 °C for 1 min, melting point 60–94 °C, every 1 °C melting point for 1 s, and 25 °C for 1–2 min. The mRNA expression levels were quantified using the 2^−ΔΔCT method.

Total RNA was extracted from cells using TRIpure isolation reagent (BioTeke, Beijing, China). qRT-PCR analysis was performed as previously described [28 (link)]. Briefly, first-strand cDNA was synthesized from total RNA using cDNA synthesis kit (BioTeke). Then, real-time PCR was performed using the SYBR Green kit (Solarbio) and detected by Exicycler TM 96 (Bioneer, Daejeon, Korea). GAPDH was acted as internal control. The primer sequences were synthesized by GenScript Biotechnology (Nanjing, China) and listed as the following: MAPK p38 forward, TAAAGCCCAGCAACCTCG, reverse, CAGCCCACGGACCAAATA; PPARγ forward, TACCACGGTTGATTTCTC, reverse, AATAATAAGGCGGGGACG; CTGF forward, GTCTTCGGTGGGTCCGTGTA, reverse, GCGGTCCTTGGGCTCATCAC; CyclinD1 forward, GAGGAGCAGAAGTGCGAAGA, reverse, GGCGGATAGAGTTGTCAGTGTAG; caspase-3 forward, GACGACAGGGTGCTACGAT, reverse, TTTCCTTACGCTCTGACTGA; β-actin forward, GGAGATTACTGCCCTGGCTCCTAGC, reverse, GGCGGACTCATCGTACTCCTGCTT. The reaction was conducted with an initial denaturing step at 94°C for 5 min, followed by 40 cycles of 94°C for 10 s, 60°C for 20 s, and 72°C for 30 s. The relative expression was analyzed by the 2^-ΔΔCt method.

Total RNA was extracted from cells with Trizol reagent (Invitrogen); 250 µg of cDNA was synthesized using Superscript III RNase H reverse transcriptase (Invitrogen) according to the manufacturer’s protocol. The total RNA of each sample was examined by 1% agarose gel electrophoresis. The mRNA levels of target genes were determined by reverse transcription polymerase chain reaction (RT-PCR) using h-Taq DNA polymerase (Solgent, Seoul, Korea) and by quantitative real-time polymerase chain reaction (qRT-PCR) using SYBR Green master mix (Hoffmann-La Roche, Basel, Switzerland) according to the manufacturers’ instructions. The specific primer sequences are displayed in Supplementary Table S1. The mRNA amplification conditions for qRT-PCR were precooling at 95 °C for 5 min, followed by 40 cycles at 95 °C for 5 s and 60 °C for 30 s. Reactions were performed in triplicate and analyzed using EXICYCLER^TM 96 (Bioneer, Daejeon, Korea). Relative expression levels were calculated using the ∆∆Ct method. GAPDH and 18S were used as internal controls for normalization of the qRT-PCR results.