Pcdnatm3.1

Cells were reverse transfected with either plasmid DNA or siRNA. Plasmid transfection was performed using the X-tremeGENE HP DNA transfection reagent (Merck, Germany) according to the manufacturer’s instructions. In brief, 100 µL transfection mix containing serum-free RPMI-1640 cell culture medium, 2 µg plasmid DNA, and 2 µL transfection reagent was incubated for 15 min at room temperature and directly added to 4 × 10⁵ cells in 2 mL of medium after seeding. The TYRO3 and the control expression vectors were purchased from OriGene, USA and Thermofisher, USA (TYRO3:pCMV6-XL4, CAT#: SC108283, pcDNA^TM3.1(+), CAT#: V790-20). For siRNA transfection, HiPerFect (Qiagen, Germany) was used according to the manufacturer’s protocol. Briefly, a transfection mix of 100 µL serum-free RPMI-1640, 100 nM siRNA, and 12 µL transfection reagent was incubated for 5 min and added to 4 × 10⁵ cells in 2.3 mL medium and incubated for 24 h before treatment. siRNAs were purchased from Qiagen, Germany (SI00288344, SI00288351). Cell viability was measured using the CellTiter 96^® AQueous One Solution Cell Proliferation Assay (Promega, Madison, WI, USA) according to the manufacturer’s recommendations. Absorbance was measured using a Tecan Plate Reader 2000 (Tecan, Switzerland).

Full-length cDNA of DmHsp22 was inserted into the eukaryotic expression vector pcDNA^TM3.1 (+) (Thermo Fisher Scientific) at Hind III and Xho I cloning sites. Polymerase chain reaction (PCR) (TransGen Biotech) and Gibson assembly (New England Biolabs) were used to construct three recombinant vectors pcDNADmHsp22, pcDNADmHsp22Flag and pcDNAFlag using oligonucleotide primers (Invitrogen) as described in Table 1. Constructs were verified by DNA profile upon restriction enzyme digestion on agarose gel and by DNA sequencing (Genomic Analysis Platform, Institut de Biologie Intégrative et des Systèmes (IBIS), Université Laval, Québec, Canada).

LINC00526 full‐length sequences were PCR‐amplified by the PfuUltra II Fusion HS DNA Polymerase (Agilent Technologies, Santa Clara, CA, USA) and the primers 5′‐CGGGATCCGCGGACTCCGCGGACAAG‐3′ (sense) and 5′‐GGAATTCCAAAATGCATCTTGTTTATTTGGC‐3′ (antisense). Then, the PCR products were cloned into the BamH I and EcoR I sites of pcDNA^TM3.1(+) (Invitrogen) and pSPT19 (Roche, Mannheim, Germany) plasmids, named as pcDNA‐LINC00526 and pSPT19‐LINC00526, respectively. The cDNA oligonucleotides silencing LINC00526 were synthesized by GenePharma (Shanghai, China) and inserted into the GenePharma SuperSilencing^TM shRNA expression plasmid pGPU6/Neo. The shRNAs target sites were 5′‐GCTCAATGTCTCATAGCTACA‐3′ (shLinc‐1) and 5′‐GGTCCTCCAAGATGAGCTTAA‐3′ (shLinc‐2). AXL ORF expression plasmid (Catalog EX‐Z7835‐M68) was purchased from GeneCopoeia (Guangzhou, China).