Miniprep kit

Manufactured by Tiangen Biotech

Sourced in China

The Miniprep kit is a laboratory tool used for the rapid purification and extraction of plasmid DNA from bacterial cultures. It provides a simple and efficient method to isolate high-quality plasmid DNA suitable for various downstream applications, such as cloning, sequencing, and transfection.

Automatically generated - may contain errors

Lab products found in correlation

Qubit flex fluorometer, by Thermo Fisher Scientific (1 mentions) Primescript 2 1st strand cdna synthesis kit, by Takara Bio (1 mentions) Lightcycler 480 system, by Roche (1 mentions) Pmdtm19 t vector, by Takara Bio (1 mentions) Quickcut not 1, by Takara Bio (1 mentions) Gel extraction kit, by Tiangen Biotech (1 mentions) Pcr purification kit, by Tiangen Biotech (1 mentions) Fatty acid standards, by Larodan (1 mentions) Total dna extraction kit, by Tiangen Biotech (1 mentions) Restriction enzyme, by New England Biolabs (1 mentions) Mobio powersoil dna isolation kit, by Qiagen (1 mentions) Fastfire qpcr premix, by Tiangen Biotech (1 mentions) Abi quantstudio 7 flex real time pcr system, by Thermo Fisher Scientific (1 mentions) Nanodrop nd 2000 uv vis spectrophotometer, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

Endotoxin-Free Plasmid DNA Miniprep Kit RNA Miniprep Kit Genomic DNA Miniprep Kit Plasmid Miniprep Kit DNA miniprep kit

6 protocols using miniprep kit

Absolute Quantification of Recombinant Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols

The qPCR
analysis was conducted
using a LightCycler 480 system (Roche, Inc., Basel, Switzerland) and
SYBR Green qPCR Master Mix (TaKaRa, Dalian, China). Absolute quantification
was performed using a standard curve. The positive recombinant VvCYP76F14-PMD
18-T plasmids mentioned above were extracted using a plasmid miniprep
kit (Tiangen, Beijing, China) according to the manufacturer’s
instructions. The concentration of the extracted plasmids was determined
using a Qubit Flex Fluorometer (Thermo Fisher Scientific, Waltham,
USA), and copy numbers for the individual genes were calculated. To
generate a standard curve, each recombinant plasmid was diluted through
eight gradients (10° to 10^–7) and used as a
template for qPCR. The primer pair used for qPCR was as follows: F:
5′-TGTTATCCAACACCATAT-3′; R: 5′-TCCCAGCTTCCTCCATCACA-3′.
The first-strand cDNA was synthesized using a PrimeScript II 1st strand
cDNA synthesis kit (TaKaRa, Dalian, China) following the manufacturer’s
instructions. All cDNA samples were diluted 10 times with RNase-free
water before being used as a template for qPCR and subsequent analyses.

Peng B., Ran J., Li Y., Tang M., Xiao H., Shi S., Ning Y., Dark A., Li J., Guan X, & Song Z. (2024). Site-Directed Mutagenesis of VvCYP76F14 (Cytochrome P450) Unveils Its Potential for Selection in Wine Grape Varieties Linked to the Development of Wine Bouquet. Journal of Agricultural and Food Chemistry, 72(7), 3683-3694.

+ Open protocol

+ Expand

Constructing Positive Control Plasmids for LAMP Assays

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

We constructed positive control plasmid DNA to evaluate the sensitivity of LAMP primer assays [22 (link), 48 (link)]. The sensitivity of LAMP primer assays was evaluated using defined templates derived from plasmids constructed to include the conserved Actin I gene fragment target. PCR products obtained following amplification of 3D7 DNA with LAMP primers F3 and B3 (Table 1) were inserted into the pMD TM19-T Vector (Takara). The PCR was performed at 94 °C for 5 min for denaturation, followed by 35 cycles (94 °C for 30 s, 54 °C for 30 s, and 72 °C for 1 min), and a final extension at 72 °C for 5 min. PCR products were cloned into the vector following the manufacturer’s instructions (Fig. S1). The recombinant pMD TM19-T plasmid DNA cloned P. falciparum Actin I gene fragment was extracted by a Miniprep kit (Tiangen) from Escherichia coli (DH5α strain). The plasmid concentration was measured by a spectrophotometer, and copy numbers were calculated by following the previously reported method [29 (link)].

Zhang J., Chen X., Pan M., Qin Y., Zhao H., Yang Q., Li X., Zeng W., Xiang Z., Wu Y., Duan M., Li X., Wang X., Mazier D., Zhang Y., Zhu W., Sun K., Wu Y., Cui L., Huang Y, & Yang Z. (2022). Application of a low-cost, specific, and sensitive loop-mediated isothermal amplification (LAMP) assay to detect Plasmodium falciparum imported from Africa. Molecular and biochemical parasitology, 252, 111529.

+ Open protocol

+ Expand

Plasmid Library Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

After liquid and plate culture, the plasmid library was extracted using a plasmid miniprep Kit (TIANGEN, #DP103). Then, QuickCut™ Not I (Takara, #1623) was used for fragments recovery. After gel recovery of the correct fragments using the Plus DNA Clean/Extraction Kit, the samples of the 509 oligos pool (1F, 3F and 5F) and the 11520 oligos pool (passage-1 and passage-5 of 1F and 3F) were sequenced directly. To obtain more complete information, we performed a PCR of the constructed plasmid to amplify the 11,520 oligos pool (passage-1 and passage-5 of 1F and 3F) using Q5® High-Fidelity DNA Polymerases and the primer pair F02/R02. The thermocycling protocol was: (1) 98 °C for 5 min, (2) 98 °C for 30 s, (3)54 °C for 30 s, (4) 72 °C for 10 s, then repeat steps 2–4 five times, followed by a final elongation at 72 °C for 5 min. The products were purified using the Plus DNA Clean/Extraction Kit (GMbiolab Co, Ltd. #DP034P) and sequenced.

Hao M., Qiao H., Gao Y., Wang Z., Qiao X., Chen X, & Qi H. (2020). A mixed culture of bacterial cells enables an economic DNA storage on a large scale. Communications Biology, 3, 416.

+ Open protocol

+ Expand

Pik3cb shRNA Plasmid Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols

The plasmid DNA (pDNA) used in the study containing Pik3cb shRNA was constructed by RIBOBIO Corporation (Guangzhou, China). The oligonucleotide sequences of Pik3cb shRNA were as follows:
sense: GATCCCGAAACTGCCGTATATGAGGAACTTGATATCCGGTTCCTCATATACGGCAGTTTTTTTTTCCAAA and
anti-sense: AGCTTTTGGAAAAAAAAACTGCCGTATATGAGGAACCGGATATCAAGTTCCTCATATACGGCAGTTTCGG.
The above oligonucleotide templates were generated by PCR amplification and were then cloned into the pcDNA3.1 expression vector. The plasmids were transformed into DH5a competent cells, isolated with a Miniprep Kit (TIANGEN BIOTECH, Beijing, China) and then subjected to sequencing. The pDNA concentration was set at 1.0 mg/ml HEPES buffer.

Wang Y., Li M., Sheng Z., Ran H., Dong J., Fang L, & Zhang P. (2023). Ultrasound-mediated delivery of Pik3cb shRNA using magnetic nanoparticles for the treatment of in-stent restenosis in a rat balloon-injured model. Journal of Radiation Research, 65(1), 47-54.

+ Open protocol

+ Expand

Molecular Cloning and Protein Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Restriction enzymes, polymerase, and ligase were purchased from New England Biolabs (Beverly, USA). The plasmid miniprep kit, total DNA extraction kit, PCR purification kit, and gel extraction kit were purchased from TianGen (Beijing, China). Primers and genes were synthesized by TsingKe (Beijing, China). Fatty acid standards were purchased from Larodan (Stockholm, Sweden). Chemical reagents were purchased from Sigma-Aldrich (St. Louis, USA) or Sinopharm (Shanghai, China). His-tag and S-tag antibodies were purchased from Proteintech (Wuhan, China).

Xiao K., Yue X.H., Chen W.C., Zhou X.R., Wang L., Xu L., Huang F.H, & Wan X. (2018). Metabolic Engineering for Enhanced Medium Chain Omega Hydroxy Fatty Acid Production in Escherichia coli. Frontiers in Microbiology, 9, 139.

+ Open protocol

+ Expand

Soil Microbial DNA Extraction and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total DNA was extracted from soil samples using the MoBio PowerSoil DNA Isolation Kit (MoBio Laboratories, Carlsbad, CA, USA) following the manufacturer's protocol with some modifications. The extracted DNA was checked on 1.0% agarose gel. And the quantity and quality was determined using NanoDrop ND-2000 UV-VIS spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).
The qPCR method was used to quantify the copy numbers of 16S rRNA genes with primer set 515F (5ʹ-GTGCCAGCMGCCGCGGTAA-3ʹ) and 806R (5ʹ-GGACTACVSGGGTATCTAAT-3ʹ) [15 ]. The reaction mixture (20 μL) contained FastFire qPCR PreMix (SYBR Green) (Tiangen, China), 0.3 μM of each primer, 0.4 μL 50×ROX reference Dye, and 1 μL of diluted DNA. The reactions were carried out on an ABI QuantStudio™ 7 Flex Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) according to the following program: 94°C for 1 min, followed by 40 cycles of 94°C for 15 s, 55°C for 34 s, and 72°C for 15 s [15 ].To prepare the standard curve, the plasmid DNA was extracted from a clone harboring the correct target insert using a Miniprep kit (Tiangen, China). Then the purified linearized plasmid DNA was serially diluted 10-fold and subjected to qPCR to generate an external standard curve. The qPCR reactions were run in quadruplicate with the DNA from all the samples.

Yu D., Wen Z., Li X., Song X., Wu H, & Yang P. (2018). Effects of straw return on bacterial communities in a wheat-maize rotation system in the North China Plain. PLoS ONE, 13(6), e0198087.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!