Agilent 2100 bioanalyzer software

We used the RNeasy protocol for isolation of total RNA from CD34⁺ cells according to the manufacturer's instructions (Qiagen GmbH, Hilden, Germany). Concentration and integrity of total RNA were assessed using NanoDrop spectrophotometer (Thermo Fisher Scientific Inc., Wilmington, Delaware, USA) and Agilent 2100 Bioanalyzer Software (Agilent Technologies, Waldbronn, Germany) comparing the ratio of 28S and 18S RNA peaks to ensure that there is minimal degradation of the RNA sample.

Total RNA was extracted from samples of V. inaequalis isolate MNH120 grown in culture, as well as infected leaves, using a Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO, USA), with DNA subsequently removed using DNase I (Invitrogen^TM, Thermo Fisher Scientific, MA, USA). RNA concentration and purity were quantified using a Nanodrop ND-1000 Spectrophotometer (NanoDrop Technologies, Rockland, DE, USA), while RNA integrity was assessed on the Agilent 2100 Bioanalyser (Agilent Technologies, Waldbronn, Germany) using an Agilent RNA 6000 Nano Kit in conjunction with Agilent 2100 Bioanalyzer software. Genomic DNA contamination was excluded by visualization of RNA on a 0.8% agarose gel and absence of polymerase chain reaction (PCR) amplification products specific to the actin gene of apple (GenBank Accession OU745002.1 [location 20,713,063–20,714,807]; primers RE45 [5′–TGACCGAATGAGCAAGGAAATTACT–3′] and RE64 [5′–TACTCAGCTTTGGCAATCCACATC–3′]) [11 (link), 136 ]. Following these quality control checks, total RNA from each of the samples was sequenced on a HiSeq X platform at Novogene (Beijing, China) via the Massey Genome Service facility (Palmerston North, New Zealand; project number MGS00286). Here, only those RNA samples with an RNA Integrity Number (RIN) value of ≥3.5 were sequenced.