Total rna kit

Total RNA was isolated from 2 to 4 5-µm FFPE sections with a Qiagen total RNA kit (Cat# 75144), and quantified by Bioanalyser. The NanoString assay was performed using the PanCancer IO 360 Gene Expression Panel with an additional 30 DNA repair genes as spike-ins (Supplemental Table 1). Gene expression was normalized to 20 housekeeping genes. The data was analyzed using the NanoString NSolver Advanced Analysis platform. Pathway- and cell-type scores were calculated as the first principal component of pathway gene normalized^{29 (link),30 (link)}. Immune score positivity was calculated from the pathway and cell-type scores using a cutoff of the ≥25% as positive for the score, and below that as negative. In the chemo-naive samples IS was called positive if the sample presented with a score of ≥25% of any of the three interferon pathways due to the overlap of the genes in the three pathways. In the chemo-exposed samples, a positive IS was assigned to a sample if the exhausted CD8 + T-cell/CD8T-cell score was among the ≥25%. A combined score was assigned using Sig3 and IS data so that tumors positive for IS, Sig3, or both being positive, and tumors, which were negative for both IS and Sig3 being negative for the combined score.

Bone MSCs or RAW264.7 cells were cultured in 24-well plates with different substrates. The total RNA was extracted from MSCs or RAW264.7 cells using Total RNA kit (Qiagen, Hilden, Germany). The RNA was reversely transcribed into complementary DNA using a reverse transcription kit (Takara, Shiga, Japan). A Bio-Rad CFX Manager system was used for qRT-PCR, and the primers used are listed in Additional file 1: Table S1. Relative levels of gene expression were obtained by normalizing the expression levels to the level of the housekeeping gene β-actin.

Total RNA was extracted from individual groups of cells using Total RNA Kit (Qiagen). After quantification of RNA concentrations using the Nanodrop spectrophotometer (ND‐100; Thermo Scientific), the RNA samples were reversely transcribed into cDNA. The relative levels of LncRNA HULC, E‐cadherin, MMP2, MMP9, N‐cadherin, Slug, Snail, and Vimentin to the control GAPDH were quantified in triplicate by qRT‐PCR using the specific primers (Table 2), the SYBR Premix Ex Taq and Taqman Universal Master Mix II (Applied Biosystems). The data were analyzed by the 2^−ΔΔCt method.

Total RNA from human frozen brain tissues (30–40 mg) was extracted using the Qiagen Total RNA kit (Qiagen, Venlo, the Netherlands), and reverse transcriptase PCR (RT-PCR) was performed using the Superscript III First Strand Synthesis SuperMix (Life Technologies) according to the manufacturer's protocol. Two microlitres of complementary DNA (cDNA) was used for testing CTNNA3 expression in the human frontal cerebral cortex and cerebellum using a forward primer designed in exon 10 (CCAATCATTTGGAAACCTTGTG) and a reverse primer mapping in exon 15 (CTCAATCTCAGCATCCAGCTTA), in order to amplify a cDNA fragment including the coding SNP rs4548513 (pSer596Asn). PCR products were purified and sequenced as described before using primers GTTACGAGCCAGGGGCTTAC and CAAGGTCAGAAACATCCTCCA.

RNA was extracted from intestinal segments (100 mg) from the ileum (5 cm from the distal ileum with obstruction) using a Total RNA Kit (Qiagen) by following the manufacturer's instructions. First-strand cDNA was synthesized from 1 μg mRNA using reverse transcriptase (Fermentas, Glen Burnie, MD) and oligo (dT) primers. The primer sequences used were as follows: Claudin 1 forward: 5′-GTGCCTTGATGGTGATTG-3′, reverse: 5′-AAAGTAGCCAGACCTGAAAT-3′. β-actin forward: 5′-TGATGGTGGGCATGGGTC-3′, reverse: 5′-CGATGGGGTACTTCAGGGTG-3′. Real-time PCR was performed using an Applied Biosystems PRISM7300 (Applied Biosystems) and SYBR Green PCR master mix (Applied Biosystems). Reagents concentration were 2× Realtime Mix 10 μL, forward primer 0.3 μL, reverse primer 0.3 μL, ddH₂O 7.4 μL, and cDNA templates 2 μL. PCR cycling conditions were 95°C for 30 sec followed by 40 cycles of 95°C for 5 sec and 50°C for 30 sec. The mRNA expression was normalized to the expression of the β-actin housekeeping gene.

Five lung tissue samples were selected from mice in each of three groups (control, BLM, and MenSC groups). Then, total RNA was extracted using a total RNA kit (Qiagen) according to the manufacturer’s instructions, and genomic DNA was removed using DNase I (TaKara). Then, the RNA quality was determined using a 2100 Bioanalyzer instrument (Agilent) and quantified using an ND-2000 instrument (NanoDrop Technologies). Only high-quality RNA samples were used to construct sequencing libraries. After quantification using a TBS380 instrument, paired-end RNA-Seq of the library was performed using an Illumina HiSeq 4000 platform. The raw RNA-Seq data produced in this study has been submitted to the NCBI Gene Expression Omnibus (GEO; https://www.ncbi.nlm.nih.gov/geo) under accession number PRJNA514227.
A RayBio® Mouse Cytokine Antibody Array (QAM-CYT-4-8) was used to detect the levels of 200 cytokines secreted by MLE-12 cells (n = 3/group). Cell culture supernatants were harvested after culturing for 48 h in the MLE-12, MLE-12 + BLM, and MLE-12 + BLM + MenSC groups. The expression of cytokines was determined by measuring the fluorescent intensities following the manufacturer’s instructions.