Genpoint kit

Manufactured by Agilent Technologies

Sourced in United States

The Genpoint kit is a laboratory equipment product provided by Agilent Technologies. It is designed for [core function]. The product details and specifications are available upon request.

Automatically generated - may contain errors

Lab products found in correlation

Silanized slides, by Merck Group (1 mentions) Nanodrop nd 1000 uv vis, by Thermo Fisher Scientific (1 mentions) Qiaamp dna mini kit, by Qiagen (1 mentions) 3 3 diaminobenzidine chromogen, by Agilent Technologies (1 mentions) Cas block, by Thermo Fisher Scientific (1 mentions) Proteinase k, by Agilent Technologies (1 mentions)

Spelling variants of this product

GenPoint (6 citations)

3 protocols using genpoint kit

HPV Detection in Paraffinized Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

The paraffinized tissue samples were submitted to the DNA extraction technique (QIAamp DNA Mini Kit, QIAGEN Ltd., Crawley, UK), DNA purity, and quantification test (NanoDrop ND-1000 UV-Vis) and PCR for gene control of human β-globin (PC03 and PC04, Life Technologies). A cancer sample was considered HPV-positive after the nPCR method had been performed in triplicate, with the use of the following primers: GP5+ and GP6+ (Life Technologies).
Histological cuts of 5 μm were placed on silanized slides (SIGMA) and submitted to the in situ hybridization reaction (ISH), using specific biotinylated probes for HPV 16 and 18 (DAKO). The ISH reactions were accompanied by a positive control (Kit GenPoint-DAKO), negative control (Kit GenPoint-DAKO, subtracting the probe), and reaction control, using a normal oral mucosa biopsy.

Soares G.R., Demathé A., Mattar N.J., Biasoli É.R, & Miyahara G.I. (2014). Absence of HPV Infection Is Associated with Smoker Patients with Squamous Cell Carcinoma of the Oropharynx. Journal of Oncology, 2014, 371570.

+ Open protocol

+ Expand

In Situ Hybridization for Chlamydophila DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

In situ hybridization was performed to detect Cp DNA (50 ng/μl) using the probe ACAACGGCTAGAAATCAATTATAAGACTGAAGTTGAGCATATTCGTGAGGGAGTGCAGATTTAGATCATGGTGTCATTGCCCAAGGTTAAAGTCTACGT. For cell permeabilization, we used Tris / 10 mM EDTA pH 9.0, endogenous peroxidase blocking with 6% H₂0₂ and reduction of non-specific proteins with protein blocker (CAS Block - Invitrogen, MA, USA). The double-stranded DNA was denatured in an oven at 95 ± 5 °C, and in situ hybridization was performed at 60 °C for 19 h in an oven. The signal was amplified using the Genpoint kit (Dako, Carpinteria, CA, USA), and the reaction was visualized with 3,3-diaminobenzidine chromogen (Dako, Carpinteria, CA, USA). The probe was omitted for the negative control. Histological sections previously diagnosed as positive for Chlamydophila pneumoniae were used as positive controls for the reactions.

Tiveron M.G., Pomerantzeff P.M., de Lourdes Higuchi M., Reis M.M., de Jesus Pereira J., Kawakami J.T., Ikegami R.N., de Almeida Brandao C.M, & Jatene F.B. (2017). Infectious agents is a risk factor for myxomatous mitral valve degeneration: A case control study. BMC Infectious Diseases, 17, 297.

+ Open protocol

+ Expand

In-situ Hybridization for HIV Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

HIV in-situ hybridization was performed as described by us previously [8 (link)]. Briefly, following deparaffinization and rehydration, tissues were permeabilized with proteinase K (Dako) and washed in diethylpyrocarbonate (DEPC)-treated PBS. Afterwards, tissues were post-fixed, quenched of endogenous peroxidase, and acetylated. Slides were washed between treatments using DEPC-treated PBS. Tissues were pre-hybridized by incubating with mRNA hybridization solution (Dako) at 45°C for one hour, followed by hybridization with 10ng HIV sense or α-sense digoxigenin (DIG)-labeled “whole genome” RNA probe (Lofstrand Labs, Ltd.) at 45°C overnight. Following overnight incubation, tissues were placed through a series of stringent washes and exposed to 20μg/ml RNase A. Detection of the probe was accomplished using a hydrogen peroxidase labeled antibody against DIG, followed by TSA (GenPoint Kit, Dako) per the manufacturer's instructions.

Tavazzi E., Morrison D., Sullivan P., Morgello S, & Fischer-Smith T. (2014). Brain inflammation is a common feature of HIV-infected patients without HIV encephalitis or productive brain infection. Current HIV research, 12(2), 97-110.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!