Differential scanning fluorimetry (DSF) was performed using the Protein Thermal Shift Dye Kit according to the manufacturer’s instructions (Thermo Fisher Scientific). Final reactions contained purified immunogen (0.125 mg/ml), 1× Protein Thermal Shift buffer, 1× Thermal Shift Dye, and 0.63× PBS. Fluorescence was monitored using a 7500 Fast Real-Time polymerase chain reaction system (Thermo Fisher Scientific) as the temperature was increased from 25° to 95°C at a ramp rate of 1%. Tm was calculated as the peak of the derivative of the melt curve. DSF reactions were performed in technical quadruplicate on each plate and in biological triplicate using three different protein preps on three separate days. Technical replicates were averaged to calculate the Tm for a biological replicate, and the three biological replicates were averaged to calculate the reported Tm.
7500 fast real time polymerase chain reaction system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 7500 Fast Real-Time Polymerase Chain Reaction (PCR) System is a laboratory instrument designed for rapid and precise nucleic acid amplification and detection. It is capable of performing real-time PCR analyses with a fast thermal cycling rate.
Automatically generated - may contain errors
Lab products found in correlation
Taqman mgb primers and probes, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Protein thermal shift dye kit, by Thermo Fisher Scientific (1 mentions)
Protein thermal shifttm dye kit, by Thermo Fisher Scientific (1 mentions)
Verso cdna kit, by Thermo Fisher Scientific (1 mentions)
Trizol extraction reagent, by Thermo Fisher Scientific (1 mentions)
Taqman mirna assay, by Thermo Fisher Scientific (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Blackprep ffpe dna kit, by Analytik Jena (1 mentions)
Qubit dsdna hs assay kit, by Thermo Fisher Scientific (1 mentions)
Qiaamp dsp virus kit, by Qiagen (1 mentions)
Kapa sybr fast master mix universal kit, by Roche (1 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (1 mentions)
Centrivap concentrator, by Labconco (1 mentions)
Qiaamp dna kit, by Qiagen (1 mentions)
Taqman snp genotype assay, by Thermo Fisher Scientific (1 mentions)
Abi prism 7500 sds software, by Thermo Fisher Scientific (1 mentions)
Taqman genotyping master mix, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Complementary dna, by Takara Bio (1 mentions)
11 protocols using 7500 fast real time polymerase chain reaction system
1
Protein Thermal Stability Analysis
2
Measuring Immunogen Thermal Stability
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Differential scanning fluorimetry was performed to measure the thermal stability of single-component immunogens using the Protein Thermal ShiftTM Dye Kit (Thermo Fisher Scientific, Cat# 4461146) according to the manufacturer’s instructions. Each 20 μl assay mixture contained 10 μg of purified immunogen in PBS (pH 7.4), 1× Protein Thermal Shift buffer, and 1× Thermal Shift Dye. The melt-curve experiments were performed on a 7500 Fast Real-Time polymerase chain reaction system (Thermo Fisher Scientific). Fluorescence readings were monitored as the temperature was increased from 25 to 95 °C at a ramp rate of 1%. Protein melt fluorescent readings were analyzed using Protein Thermal ShiftTM software v 1.4 (Thermo Fisher Scientific), and the melting temperature (Tm) was calculated as a peak of the derivative melt curve. Protein melt-curve experiments were performed in five technical replicates on each plate and in biological triplicate. Tm for a biological replicate was calculated by averaging technical replicates, and the reported Tm was calculated by averaging three biological replicates.
3
Quantification of mRNA and miRNA Expression
4
FFPE DNA and cfDNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA from FFPE samples was extracted with the blackPREP FFPE DNA kit (Analytic Jena, Germany) and cfDNA isolation was performed from 3 to 4 mL of plasma using the QIAamp DSP Virus kit (QIAGEN, Germany) according to protocol. The isolated cfDNA was concentrated by complete drying at 37°C in the CentriVap Concentrator (LABCONCO) and then by dissolution in 40 μL of ultrapurified water. The concentration of DNA was measured using the Qubit BR dsDNA Assay Kit or the Qubit HS dsDNA Assay Kit (Life Technologies) on the Qubit 2.0 Fluorometer (Invitrogen). DNA quality from the FFPE blocks was then determined by the KAPA SYBR Fast Master Mix Universal Kit (KAPA Biosystems) in the 7500 Fast Real-Time Polymerase Chain Reaction (PCR) System (Applied Biosystems). Preparation of the PCR and the PCR program was performed according to the TruSight Tumor (TST) 26 protocol (Illumina). The total DNA input was calculated based on the obtained ΔCT values.
5
DNA Isolation and SNP Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from all blood samples using QiaAmp DNA Kit (Qiagen). A TaqMan SNP genotype assay was used for analysis of the IL-32 rs28372698 (ID C-64281225-10) (Applied Biosystems). Ten nanograms of DNA was mixed with TaqMan Genotyping Master Mix (Applied Biosystems) and was amplified using the 7500 Fast Real-Time Polymerase Chain Reaction (PCR) system (Applied Biosystems). Amplification was performed using an initial cycle at 50˚C for 2 min, followed by one cycle at 95˚C for 10 min and finally 40 cycles at 95˚C for 15 sec and at 60˚C for 1 min. The manual calling option in the allelic discrimination application ABI PRISM 7500 SDS software, (version 1.3.1; Applied Biosystems) was used to assign the genotypes.
6
Quantitative Analysis of Osteoblast Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from osteoblast cells using the TRIzol Reagent (Thermo Fisher Scientific), according to the manufacturer’s instruction. For the quantitative reverse transcription-polymerase chain reaction analysis, total RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Data analysis using the SYBR Green real-time reverse transcription-polymerase chain reaction technique was performed with the 7500 Fast Real-Time Polymerase Chain Reaction System (Applied Biosystems). We used the following polymerase chain reaction primers: Type I collagen, 5’-CTGGCTTTGCCGGCC-3’ (forward) and 5’-ACCTTTAACACCAGTATCACCAGGT-3’ (reverse); alkaline phosphatase, 5’-GGAATACGAACTGGATGAGAAGGCC-3’ (forward) and 5’-CAGTTCAGTGCGGTTCCAGACATAG-3’ (reverse); camp, 5’-GCTGTGGCGGTCACTATCAC-3’ (forward) and 5’-TGTCTAGGGACTGCTGGTTGA-3’ (reverse); and 18S rRNA, 5‘-GCAATTATTCCCCATGAACG-3’ (forward) and 5‘-GGCCTCACTAAACCATCCAA-3’ (reverse).
Relative fold changes in transcript levels were calculated using the 2-ΔΔCT method (where CT is the threshold cycle), using the housekeeping gene that encodes 18S rRNA as a reference standard for the amount loaded and the quality of cDNA.
Relative fold changes in transcript levels were calculated using the 2-ΔΔCT method (where CT is the threshold cycle), using the housekeeping gene that encodes 18S rRNA as a reference standard for the amount loaded and the quality of cDNA.
7
Genotyping of NKC region SNPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eight SNPs of the NKC region closely associated with NK cell cytotoxic activity according to Hayashi et al. [28 (link)] were genotyped: seven located in the NKG2D gene and one in the promoter region of NKG2A (see Table 8 ). Following the criteria described by Hayashi et al., these SNPs were selected among the 1300 SNPs registered for this region in the Celera Genomic database and NCBI database. Briefly, selection was based on (1) allele frequency >10% in Caucasian and Japanese populations and (2) strong association with NK cell cytotoxic activity (p-values < 0.001) [28 (link)]. Genotyping was made using TaqMan-Allelic discrimination methods in a 7500-fast real-time polymerase chain reaction system (Applied Biosystems (AB), CA). Predesigned TaqMan assays for the selected SNPs were acquired from AB. The NKC10 SNP was a custom design made by TaqMan assay design tool on the AB website (NKC10 Forward primer: GGAGAAAAGGACATGCCCTCATAT; NKC10 Reverse primer: GTCTCTAAAGGGATGCAAAATGATAATAAAATGT). Results were analyzed using allelic discrimination software (AB).
8
Genotyping of Vitamin D Pathway Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from peripheral blood leukocytes [38 (link)]. DNA samples were diluted to 2 ng/mL. Duplicate measurements were performed in 10% of the samples to assess the internal quality of genotype data. Molecular genotyping for rs4588 (substitution of C for A), rs7041 (substitution of T for G), and rs2282679 (substitution of A for C) was performed through real-time polymerase chain reaction (PCR) (7500 Fast Real-Time Polymerase Chain Reaction System, Applied Biosystems, California, USA), using the allelic discrimination assay with TaqMan MGB primers and probes (Applied Biosystems, California, USA).
9
Retinal RNA Isolation and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolation of total RNA from the retinal samples was conducted with Trizol (Invitrogen, Carlsbad, CA, USA), and then reverse-transcribed into complementary DNA (Takara Bio, Tokyo, Japan) following the manufacturer’s instructions. An Applied Biosystems 7500 Fast Real-Time polymerase chain reaction system was used to perform amplification with the following thermocycling parameters: 95°C for 30 seconds; 40 cycles of 95°C for 3 seconds and 60°C for 30 seconds; and 95°C for 5 seconds. The primer sequences are shown in Table 1
10
Genotyping Vitamin D Receptor Polymorphisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from peripheral blood leukocytes [32 (link)]. The DNA samples were diluted to 2 ng/mL. Molecular genotyping was performed through real-time polymerase chain reaction (7500 Fast Real-Time Polymerase Chain Reaction System, Applied Biosystems, CA, USA), using the allelic discrimination assay with TaqMan MGB primers and probes (Applied Biosystems, CA, USA).
For genotyping the single nucleotide polymorphisms (SNPs) Apa-I and Taq-I, the following were added: TaqMan Master mix (2.5 μL), TaqMan assay (0.25 μL), and H2O (1.25 μL), for a final volume of 4 μL per sample, followed by addition of 1μLof DNA for a total reaction volume of 5 μL. To genotype SNP Bsm-I, TaqMan Master mix (5.0 μL), TaqMan assay (0.50 μL), and H2O (3.5 μL) were added for a final volume of 9 μL per sample, and 1 μL of DNA was added for a total reaction volume of 10 μL. Reaction conditions for all polymorphisms were: 10 min at 95 °C after 50 cycles of denaturation at 95 °C (15 s) and annealing at 60 °C (1 min). Endpoint fluorescent readings were performed in the 7500 Fast System Sequence Detection Software version 1.4 environment. The internal quality of genotype data was assessed by typing 10% of blinded samples in duplicate.
For genotyping the single nucleotide polymorphisms (SNPs) Apa-I and Taq-I, the following were added: TaqMan Master mix (2.5 μL), TaqMan assay (0.25 μL), and H2O (1.25 μL), for a final volume of 4 μL per sample, followed by addition of 1μLof DNA for a total reaction volume of 5 μL. To genotype SNP Bsm-I, TaqMan Master mix (5.0 μL), TaqMan assay (0.50 μL), and H2O (3.5 μL) were added for a final volume of 9 μL per sample, and 1 μL of DNA was added for a total reaction volume of 10 μL. Reaction conditions for all polymorphisms were: 10 min at 95 °C after 50 cycles of denaturation at 95 °C (15 s) and annealing at 60 °C (1 min). Endpoint fluorescent readings were performed in the 7500 Fast System Sequence Detection Software version 1.4 environment. The internal quality of genotype data was assessed by typing 10% of blinded samples in duplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!