Plko 1 neo

Manufactured by Addgene

PLKO.1 neo is a lentiviral expression vector that allows for the expression of a gene of interest and selection of transduced cells using neomycin resistance. The vector contains the necessary lentiviral components for viral packaging and transduction.

Automatically generated - may contain errors

Lab products found in correlation

Pbabe puro, by Addgene (1 mentions) Pmdg 2, by Addgene (1 mentions) Lenticrispr v2 blast, by Addgene (1 mentions) Lenticrispr v2, by Addgene (1 mentions) Pspax, by Addgene (1 mentions) Pcdna3, by Thermo Fisher Scientific (1 mentions) Nucleobond xtra midi ef kit, by Macherey-Nagel (1 mentions) Hygromycin, by Merck Group (1 mentions) Polybrene, by Merck Group (1 mentions) Plko 1 hygro, by Addgene (1 mentions) Amicon ultra centrifugal filter, by Merck Group (1 mentions)

5 protocols using plko 1 neo

Stable Overexpression and Knockdown of FAM134B

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full‐length human FAM134B cDNA was amplified by PCR and subcloned into the lentiviral vector pBABE‐puro (plasmid # 1764; Addgene, Cambridge, MA, USA) to establish a Bel‐7402 cell line that stably overexpressed FAM134B. The target sequences of FAM134B were used to establish a stable HLF cell line with FAM134B knockdown. Briefly, three DNA fragments (FAM134B shRNA#1 CCG GGC AGC TAT CAA AGA CCA GTT A, FAM134B shRNA#2 CCG GCC ACA GAC AGA CAC TTC TGA T, and FAM134B shRNA#3 CCG GCT ACT GTT ACT GTG TGC ATT T) were subcloned into the lentiviral vector pLKO.1 neo (plasmid # 13425; Addgene). The target sequences of Snail shRNA#1 and #2 were AAC TGC AAA TAC TGC AAC A and ACT CAG ATG TCA AGA AGT A, respectively. The target sequences of β‐catenin siRNA#1 and #2 were AGC UGA UAU UGA UGG ACA G and CAG UUG UGG UUA AGC UCU U, respectively. The plasmids pMD2.G and psPAX2 were gifts from Didier Trono (plasmids # 12259 and # 12260; Addgene). To obtain stable cell clones, HCC cells were infected with lentivirus for 24 h and selected with growth medium containing 5 μg·mL⁻¹ of puromycin for 3 days and/or 400 μg·mL⁻¹ of G418 for 7 days. The stability of the transfected clones was validated by western blot analysis.

Zhang Z., Chen J., Huang W., Ning D., Liu Q., Wang C., Zhang L., Ren L., Chu L., Liang H., Fan H., Zhang B, & Chen X. (2019). FAM134B induces tumorigenesis and epithelial‐to‐mesenchymal transition via Akt signaling in hepatocellular carcinoma. Molecular Oncology, 13(4), 792-810.

+ Open protocol

+ Expand

Skp2 Knockdown via Lentiviral shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small hairpin RNAs (shRNAs) targeting Skp2 (TRCN0000007534) was cloned into lentiviral vector pLKO.1 neo (Addgene number 10878) and random sequence scrambled shRNA [20 (link)] was used as control. Lentivirus production was carried out as described in [20 (link)]. Lentivirus infection was performed in the presence of 8 μg/mL polybrene. Cells were lysed in 1% SDS lysis buffer 48 hours after transduction.

Alvarez Orellana J., Kwun H.J., Artusi S., Chang Y, & Moore P.S. (2020). Sirolimus and Other Mechanistic Target of Rapamycin Inhibitors Directly Activate Latent Pathogenic Human Polyomavirus Replication. The Journal of Infectious Diseases, 224(7), 1160-1169.

+ Open protocol

+ Expand

Lentiviral Vectors and CRISPR Knockouts

Check if the same lab product or an alternative is used in the 5 most similar protocols

The lentiviral backbones lentiCRISPR v2 (#52961), lentiCRISPR v2-Blast (#83480) and plko.1 neo (13425) as well as helper plasmids pMDG.2 (#12259) and psPAX (#12260) were purchased from Addgene. MMP14 pHluorin plasmid was kindly provided by Kay Oliver Schink, Harald Stenmark and Philippe Chavrier. The BacMam mCherry-zyxin viral vector was used for transient zyxin expression [24 (link)]. CLCB QQN RFP vector was provided by P. McPherson. The Gateway Destination vector pDest RFP-C was used to clone CLCA and CLCB at the C-terminal end of RFP as well as the cDNA of human CLCA and CLCB (pENTR CLCA and pENTR CLCB) were obtained from the Vector and Clone Repository and repository genome wide cDNA library Gateway Full ORF Clones distributed by the GPCF available at the DKFZ. The following target gRNA sequences were used for genome editing: For single KO clones: CLCA−− (5’GCCTGGACGGCGGCGCCCCC3`) and CLCB−/− (5’AGAGAACGACGAGGGCTTCG3´). For double KO clones: CLCA−/− (5´GACGCGCCCGCACTCTCACC 3)´ and CLCB−/− (5´AGAGAACGACGAGGGCTTCG 3´). Following target sequence was used for shRNA mediated protein knock-down: MMP14 (5’CATTGCATCTTCCCTAGATAG 3´).

Mukenhirn M., Muraca F., Bucher D., Asberger E., Cappio Barazzone E., Cavalcanti-Adam E.A, & Boulant S. (2021). Role of Clathrin Light Chains in Regulating Invadopodia Formation. Cells, 10(2), 451.

+ Open protocol

+ Expand

Overexpression and Knockdown of Prdm10 in mESCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

For overexpression studies, full-length Prdm10 was cloned by gene synthesis (AITBiotech) based on sequence information obtained from RNA-seq analysis and Ensembl transcript annotations. For stable expression in mESCs, Prdm10 was ligated into the NheI and BamHI sites of the pJ549 PiggyBac transposase expression vector (DNA 2.0), modified to contain an N-terminal FLAG tag. For transient transfections, Prdm10 was cloned into pcDNA3.1 (Invitrogen) downstream of an N-terminal FLAG tag via EcoRI and NotI restriction sites. For the construction of shRNA lentiviral vectors, gene-specific hairpin sequences were selected from the RNAi Consortium TRC lentiviral shRNA library and cloned into pLKO.1-Neo (Addgene, #13425) as annealed oligonucleotides (Supplementary Data 8). Endotoxin-free plasmids were prepared using the Nucleobond Xtra Midi EF Kit (Macherey-Nagel). All constructs were verified by Sanger sequencing.

Han B.Y., Seah M.K., Brooks I.R., Quek D.H., Huxley D.R., Foo C.S., Lee L.T., Wollmann H., Guo H., Messerschmidt D.M, & Guccione E. (2020). Global translation during early development depends on the essential transcription factor PRDM10. Nature Communications, 11, 3603.

+ Open protocol

+ Expand

Culturing and Manipulating Pancreatic Ductal Epithelial Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Isolation, culture, and adenoviral infection of pancreatic ductal
epithelial cells (PDECs) was carried out as previously described (Pylayeva-Gupta et al., 2012 (link)).
CRISPR-generated cell lines are described in the detailed Methods. HEK293T
cells were purchased from the ATCC and maintained in DMEM with 10% FBS and
penicillin-streptomycin at 37°C. Scramble control shRNA (Sarbassov et al., 2005 (link)) and shRNAs
against CXCL2 and CXCL5 were cloned into
the lentiviral pLKO.1 neo (gift from Sheila Stewart) and pLKO.1 hygro (gift
from Bob Weinberg) vectors, respectively, obtained from Addgene. Lentiviral
particles were generated by transfecting HEK293T cells using Xtremegene 9
with the pLKO.1 vector, the packaging construct (psPAX2, gift from Didier
Trono), and the envelope plasmid (pMD2G, gift from Didier Trono).
Supernatants containing viral particles were collected over a period of 48 h
and stored at 4°C. Following final collection, supernatants were
filtered through a 0.45-μm-pore-size syringe filter and concentrated
using 100-MWCO Amicon Ultra centrifugal filters (Millipore). A multiplicity
of infection (MOI) of 10 was used for lentiviral infection of PDEC cells in
the presence of 10 μg/ml Polybrene (Chemicon), and infected cells
were selected using 150 μg/ml hygromycin (Sigma) or 400 μg/ml
G418 (Sigma). All data representative of 3 independent clones from 3
independent experiments

Siolas D., Vucic E., Kurz E., Hajdu C, & Bar-Sagi D. (2021). Gain-of-function p53R172H mutation drives accumulation of neutrophils in pancreatic tumors, promoting resistance to immunotherapy. Cell reports, 36(8), 109578.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!