Total RNA was extracted using an RNA Purification Kit (EZBioscience, USA) and cDNA was obtained from 500 ng of total RNA using the Reverse Transcription Kit (EZBioscience). Next, qRT-PCR was performed using SYBR Green qPCR Master Mix (EZBioscience). Relative gene expression was calculated using the 2-ΔΔCT method, and GAPDH was used as a reference for normalization. The primers were purchased from BioTNT, and primer sequences are shown in Table 1 .
Reverse transcription kit
Manufactured by EZBioscience
Sourced in United States
The Reverse Transcription Kit is a set of reagents designed for the conversion of RNA to complementary DNA (cDNA) through the process of reverse transcription. The kit includes all the necessary components, such as reverse transcriptase enzyme, buffer, and primers, to facilitate this fundamental step in molecular biology workflows.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green qpcr master mix, by EZBioscience (6 mentions)
Rna purification kit, by EZBioscience (6 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Sybr green master mix, by EZBioscience (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Tb green premix ex taq 2, by Takara Bio (1 mentions)
Tissue rna purification kit, by EZBioscience (1 mentions)
Rna extraction kit, by EZBioscience (1 mentions)
Ez press rna purification kit, by EZBioscience (1 mentions)
Glucose assay kit, by Beyotime (1 mentions)
Oe cloud, by OE Biotech (1 mentions)
Bacterial rna extraction kit, by Vazyme (1 mentions)
Nad nadh assay kit, by Beyotime (1 mentions)
Pyruvate assay kit, by Solarbio (1 mentions)
Atp assay kit, by Beyotime (1 mentions)
Polyvinylidene difluoride pvdf membrane, by Merck Group (1 mentions)
Dulbecco s modified eagle medium, by Thermo Fisher Scientific (1 mentions)
Phosphate buffered saline (pbs), by Nacalai Tesque (1 mentions)
Alkaline phosphatase alp assay kit, by Beyotime (1 mentions)
15 protocols using reverse transcription kit
1
Quantitative Real-Time PCR Analysis of Gene Expression
2
Quantification of Gene Expression by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted using an RNA Purification Kit (EZBioscience, B0004). After removing genomic DNAs with a DNA remover, total RNAs were reverse transcribed into cDNAs using the Reverse Transcription Kit (EZBioscience, A0010GQ). cDNA amplification was performed using the TB Green® Premix Ex Taq™ II (TaKaRa, RR820A). The 2−ΔΔCt method was used to calculate gene expression levels relative to GAPDH. Primers were listed in Table S1 .
3
Evaluating Osteogenic Differentiation of rBMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
rBMSCs were seeded in a 6-well plate (1 × 105 cells/well) and cultured overnight. They were subsequently treated with Co-MMSNs (final concentration 10 μg/mL) for 7 days, total RNA was extracted using a tissue RNA Purification Kit (EZBioscience, USA), and the RNA was reverse-transcribed using the Reverse Transcription Kit (EZBioscience), according to the manufacturer’s instructions. All q-PCR reactions were performed in triplicate using a 10 mL reaction system (Takara, Japan), including cDNA, primers, and SYBR-green mix. The following protocol was used to perform PCR: a 10-minute denaturation stage at 95 °C followed by 40 cycles of 15s at 95 °C and 60s at 60 °C. Table 1 contains information on the gene-specific primers. The 2-ΔΔCT method was used to assess the relative quantification of gene expression.
Primer Sequences
| Gene | Forward (5’–3’) | Reverse (5’–3’) |
|---|---|---|
| ALP | CCGCAGGATGTGAACTACT | GGTACTGACGGAAGAAGGG |
| Runx2 | ACTTCCTGTGCTCGGTGCT | GACGGTTATGGTCAAGGTGAA |
| OCN | CAGACAAGTCCCACACAGCA | CCAGCAGAGTGAGCAGAGAGA |
4
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The culture medium was discarded, and the treated cells were washed with PBS. Total cellular RNA was extracted using the RNA extraction kit (EZBioscience; USA) according to the manufacturer's instructions. The cDNA was synthesized using the reverse transcription kit (EZBioscience; USA) according to the corresponding RNA concentration determined by Nanodrop 2000 (Thermo; US). 10 ul of the reaction system was finally prepared for PCR detection using the PCR kit (EZBioscience; USA). The Ct values were read, and GAPDH was used as a reference to analyze gene expression levels. The primers for the genes used in this study are shown in Table S2 (Supporting Information).
5
Quantitative Analysis of Inflammatory Markers in BV-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the BV-2 cells of different treatment groups using the EZ-Press RNA purification kit (EZ Bioscience, Roseville, CA, USA). Then, a Reverse Transcription Kit (EZ Bioscience, Roseville, CA, USA) was used to convert the extracted RNA into cDNA using specific primers (EZ Bioscience, Roseville, CA, USA) to amplify the cDNA templates. The mRNA levels of various genes (COX2, TNF-α, IL-1β, and IL-6) compared with GAPDH were evaluated by 2−ΔΔCt. The primer sequences used in this study refer to previous studies [52 (link),53 (link),54 (link)] (Table 1 ).
6
Tissue RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from tissue samples was isolated using TRIzol (15596018, Invitrogen, Carlsbad, CA) per the manufacturer's instructions. Complementary DNA was synthesized using 500 ng of total RNA using the Reverse Transcription Kit (EZBioscience, MN, USA) per the manufacturer's instructions. qRT-PCR was performed using SYBR Green qPCR Master Mix (EZBioscience, MN, USA). Relative gene expression was calculated using the 2−ΔΔCT method. PCR was performed using three biological and technical replicates and normalized using the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase. Primer sequences are listed in Supplementary Table S1 .
7
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prior to PCR, total RNA was extracted using RNA Purification Kit (EZBioscience, USA). The RNA was reverse-transcribed by 500 ng of total RNA from each sample using Reverse Transcription Kit (EZBioscience, USA). Next, the cDNA was amplified with SYBR Green qPCR Master Mix (EZBioscience, USA). Data were analyzed, and the relative expression levels were calculated by the 2-ΔΔCT method. Housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for normalization. All reactions were carried out with three biological replicates, and each analysis consisted of three technical replicates. The primer sequences were designed by Oligo 7.0 software and are shown in Table 1
8
Transcriptomic Analysis of S. aureus Biofilm
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S. aureus biofilms were collected after different treatments and immediately stored in liquid nitrogen. The samples were detected for transcriptomic analysis with the mass spectrometry platform of OE Biotech (Shanghai, China). The data obtained were further analyzed using OE Cloud (OE Biotech) software.
qPCR was used to validate the expression levels of genes that were significantly regulated in the transcriptomics analysis results. Briefly, total S. aureus RNA was extracted from biofilms using a bacterial RNA extraction kit (Vazyme, China). cDNA was synthesized using a reverse transcription kit (EZBioscience, USA) after the determination of RNA concentration. cDNA obtained was subsequently amplified using SYBR Green Master Mix (EZBioscience, USA) and a LightCycler 480 (Roche, USA). The 16s RNA was selected as the housekeeping gene and the primers used were listed inTable S1 .
Finally, the glucose metabolism of S. aureus in biofilms was measured using the Glucose Assay Kit (Beyotime, China), Pyruvate Assay Kit (Solarbio, China), ATP Assay Kit (Beyotime, China), and NAD+/NADH Assay Kit (Beyotime, China), respectively.
qPCR was used to validate the expression levels of genes that were significantly regulated in the transcriptomics analysis results. Briefly, total S. aureus RNA was extracted from biofilms using a bacterial RNA extraction kit (Vazyme, China). cDNA was synthesized using a reverse transcription kit (EZBioscience, USA) after the determination of RNA concentration. cDNA obtained was subsequently amplified using SYBR Green Master Mix (EZBioscience, USA) and a LightCycler 480 (Roche, USA). The 16s RNA was selected as the housekeeping gene and the primers used were listed in
Finally, the glucose metabolism of S. aureus in biofilms was measured using the Glucose Assay Kit (Beyotime, China), Pyruvate Assay Kit (Solarbio, China), ATP Assay Kit (Beyotime, China), and NAD+/NADH Assay Kit (Beyotime, China), respectively.
9
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of the cultured cells was extracted using an RNA Purification Kit (EZBioscience, Roseville, MN, USA). After measuring the concentration of RNA, Complementary DNA was synthesized using a Reverse Transcription Kit (EZBioscience) and used as template to perform qRT-PCR using SYBR Green Master Mix (EZBioscience). Primers were obtained from Sangon Biotech (Shanghai, China) (Table 1 ). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as internal control.
10
Biomaterials for Osteogenic Differentiation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amelogenin (AM, SAB, USA); sodium alginate (Sigma, USA); calcium chloride (Sigma, USA); phosphate-buffered saline (PBS, Nacalai tesque, USA); Dulbecco's modified eagle medium (Gibco, USA); mouse macrophage colony aggregation factor (Peprotech, USA); Alizarin Red S (ARS) staining solution (Leagene, China); lipopolysaccharide (Sigma, USA); polyvinylidene difluoride (PVDF) membrane (Millipore, USA); Cell Counting Kit-8 (CCK-8); cell proliferation and toxicity assay kit (Meilunbio, China); alkaline phosphatase (ALP) assay kit (Beyotime, China); reverse transcription kit (EZBioscience, China); RIPA lysis buffer (Biosharp, Beijing, China); BCA kit (Leagene, Beijing, China); chemiluminescence assay kit (Enzyme, China); EDTA (Guangzhou Chemical Factory, China); 4% paraformaldehyde solution (Guangzhou Chemical Factory, China); hematoxylin-eosin stain (Ziker Bioziker, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!