ESCs were treated with trypsin and plated at a density of 5 × 106 cells per 10 cm MEF plate 24 h prior to the transfection. The vectors were used at the concentration of 2 ng of pPBCAG-Venus-IP and pPBCAG-H2BtdTomato-IH and 1 ng of CAGG-PBase (pCyL43) per 5x106 cells. All vectors were kindly supplied by Professor Azim Surani (The Gurdon Institute, University of Cambridge). Nucleofection was carried out using the Mouse ES Cell Nucleofector Kit (Lonza). 5 × 106 cells were re-suspended in 90 ul Mouse ES Nucleofector Solution and mixed with the targeting vectors, which were diluted in 10 ul Mouse ES Nucleofector Solution. The cells were nucleofected using the A-013 program and then seeded onto MEF plates at 5 × 106 cells per plate. After 24 h without selection, the medium was replaced with fresh ESC medium containing the appropriate selection agent (1.75 ug/ml Puromycin or 150 ug/ml Hygromycin). Cells were selected for 9 days with the medium changed every 1–2 days.
Mouse es cell nucleofector kit
Manufactured by Lonza
Sourced in Switzerland
The Mouse ES Cell Nucleofector Kit is a laboratory equipment product designed for the efficient transfection of mouse embryonic stem cells (ES cells). It facilitates the introduction of DNA, RNA, or other molecules into mouse ES cells using an electroporation-based method.
Automatically generated - may contain errors
Lab products found in correlation
Amaxa nucleofector, by Lonza (3 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Geneticin g418, by Thermo Fisher Scientific (2 mentions)
Anti ctcf antibody, by Merck Group (2 mentions)
Px330, by Addgene (1 mentions)
Px330, by Lonza (1 mentions)
Nucleofector 2, by Lonza (1 mentions)
Pcag cre gfp, by Addgene (1 mentions)
Pcag ires gfp, by Addgene (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Antisense lna gapmer, by Qiagen (1 mentions)
Antisense lna gapmer control, by Qiagen (1 mentions)
Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (1 mentions)
Mem non essential amino acid, by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Sodium pyruvate, by Thermo Fisher Scientific (1 mentions)
Esgro lif, by Merck Group (1 mentions)
Fugene hd, by Promega (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
15 protocols using mouse es cell nucleofector kit
1
Transient Transfection of Mouse ESCs
2
Generation of Cnot3 Mutant ESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The guide RNA (gRNA) used to generate the Cnot3-T292A/S294A mutant ESCs was 5′-GATTTAGACTTGGACCCACC-3′. The gRNA was cloned into pX330 (Addgene, USA; plasmid: 42230) using forward primer 5′-CACCGGATTTAGACTTGGACCCACC-3′ and reverse primer 5′-AAACGGTGGGTCCAAGTCTAAATCC-3′
The 110-base-paired single-stranded (ss) donor DNA used to target Cnot3 in exon 10 carrying the mutations was 5′-ACTCTGAAGATGATAAGAAGAGAGGCCGATCTGCGGATGCTGAAGTCAGCCAGGTGGGTCCAAGTCTAAATCTGATGGTTTGTAACTTGTTTATTGCGTGGTCTCCAAAG-3′
Mouse ESCs (4 × 106 cells) were transfected with 3 μg of pX330 plasmid carrying the gRNA, 4 μg of the donor ssDNA, and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector Kit (Lonza, Switzerland) following the manufacturer’s protocol. One day posttransfection, cells were subjected to puromycin selection (1.5 μg/ml) for 24 h. A week after transfection, individual clones were picked and genotyped by allele-specific nested PCR. Mutant genotypes were confirmed by sequencing.
The 110-base-paired single-stranded (ss) donor DNA used to target Cnot3 in exon 10 carrying the mutations was 5′-ACTCTGAAGATGATAAGAAGAGAGGCCGATCTGCGGATGCTGAAGTCAGCCAGGTGGGTCCAAGTCTAAATCTGATGGTTTGTAACTTGTTTATTGCGTGGTCTCCAAAG-3′
Mouse ESCs (4 × 106 cells) were transfected with 3 μg of pX330 plasmid carrying the gRNA, 4 μg of the donor ssDNA, and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector Kit (Lonza, Switzerland) following the manufacturer’s protocol. One day posttransfection, cells were subjected to puromycin selection (1.5 μg/ml) for 24 h. A week after transfection, individual clones were picked and genotyped by allele-specific nested PCR. Mutant genotypes were confirmed by sequencing.
3
Knock-in EGFP at Mouse AVP Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To knock-in EGFP at the mouse AVP gene, Xanthomonas TAL Nucleases (XTN; Transposagen Gene Editing Kit; Transposagen Biopharmaceuticals, Inc., Lexington, KY, USA) were designed to cause a mutation at the first exon of the vasopressin precursor gene around the initial ATG. For recombination, homology arms (5’: 0.9 kbp, 3’: 0.9 kbp) were amplified by polymerase chain reaction (PCR) from 129J mouse genomic DNA (from EB5 ES cells). The cDNA of enhanced GFP (EGFP; BD Biosciences) was fused into the first exon of the AVP. A PGK promoter-driven hygromycin-resistance selection cassette flanked by loxP sites was inserted downstream of EGFP. Vectors for the XTN pair with linearized targeting vector were co-transfected by electroporation (Mouse ES Cell Nucleofector™ kit and Nucleofector II; Lonza, Basel, Switzerland; Cat# VPH-1001) into EB5 ES cells. Homologous recombinant ES cells were selected with hygromycin and then screened by PCR. Targeted clones were confirmed by a PCR analysis with the 3’, 5’ and neo probes. The floxed PGK-hygro cassette was removed from subclones by transient transfection with Cre-expressing plasmid (pCAG-Cre:GFP; Addgene, #13776) using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc. Cat# 11668030). The resultant subclones exhibited abilities to differentiate into hypothalamic neurons, including vasopressin.
4
Ube2d3 Mutant Expression in E14 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type Ube2d3 and Ube2d3-S138A, -S138E, and -S138D mutants were cloned into the expression vector pCAG-IRES-GFP (Addgene, plasmid #11159). E14 cells (5 × 106) were transfected with 10 μg of the appropriate plasmid with the Mouse ES Cell Nucleofector Kit (Lonza) and allowed to grow for 48 h after transfection. Cells were then collected and sorted for GFP expression. UBE2D3 protein levels were analyzed by western blot.
5
Modulating TERRA Expression in mESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse 16.7 embryonic stem cells (ESCs) were grown until 70% confluency and trypsinized. After removing feeder cells, ES cells were maintained on gelatinized dishes with feeder-conditioned medium. Followed by one passage after feeder removal, LNA transfection was performed using a mouse ES cell nucleofector kit (Lonza, Cat#VPH-1001). Cells were fed with fresh medium 3 h before transfection. A total of 3 × 106 mESCs were transfected with LNA gapmer oligos at a concentration of 4 μM in 100 μl nucleofector solution using A-23 program. Cells were plated onto gelatinized 6-well plates with 2 ml of half feeder-conditioned medium (medium from feeders grown in mES medium for 12 h) and half fresh mESCs medium. Anti-sense TERRA (5′-TAACCCTAACCCTAAC-3′) and control (scramble) LNA (5′-CACGTCTATACACCAC-3′) gapmers were purchased from Qiagen with modified LNA bases and phosphothiolated backbone modification.
6
Generation of Ube2d3-S138A Mutant ESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To produce E14 Ube2d3-S138A mutant ESC, 4 × 106 cells were transfected with 3 μg of pX330 (Cong et al. 2013 (link); Addgene plasmid #42230) plasmid carrying the appropriate gRNA, 4 μg of the donor ssDNA and 3 μg of a puromycin resistance plasmid (pCAG-puroR) using the Mouse ES Cell Nucleofector Kit (Lonza). One day after transfection, cells were subjected to puromycin selection (1.5 μg/ml) for 24 h. A week after transfection, individual clones were picked and genotyped by nested PCR. Mutant genotypes were confirmed by sequencing. For details of the gRNAs and donor sequences used in this study, see supplementary Methods , Supplementary Material online.
7
Targeted Integration of ZFN and Donor in iPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For targeted integration into Fib.S fibroblasts, 1x105 cells were transfected 24 h after seeding with Lipofectamine 2000 (Life Technologies). 1.6 μg of endotoxin-free DNA was mixed with 4.8 μl of transfection reagent in 200 μl OptiMEM (Gibco). The ZFN expression plasmids were co-transfected with the donor pJet.SAE8586Neo at different ratios and filled up with pUC118 to 1.6 μg. Selection with 500 μg/ml of G418 (Sigma-Aldrich) was applied 5 days after transfection for 7 days. iPSCs were grown feeder-free before and after transfection. 3x106 cells were nucleofected with 10 μg of pJET.SAE8586Neo and 5 μg of each ZFN expression plasmid using the Mouse ES Cell Nucleofector Kit (LONZA) and Nucleofector II with program A-030. After 5 days of recovery, G418 selection was applied for 7 days at a concentration of 400 μg/ml. After 1 week, iPSC clones were isolated and cultivated on feeders.
8
Jpx Depletion in Differentiating ES Cells
9
Genetic Reversal of TetR Fusion Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TetO-mESCs were transduced with YR111 and YR112 and mCherry-positive clones were isolated. For genetic reversal of TetR fusion protein binding, reporter cell clones expressing conditional TetR fusions were transduced with Cre recombinase using the mouse ES Cell Nucleofector Kit (Lonza) and Thy1.1-positive cells were sorted out after 24–36 h. Flow cytometry analysis of mCherry and GFP expression was carried out after 96 h. Both nuclear protein extracts and genomic DNA were collected reporter cells prior (mCherry-positive) and after (mCherry-negative) transfection with Cre recombinase.
10
siRNA-mediated Hmgn1/2 knockdown and rescue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For siRNA knock-down, 25 nM ON-TARGET SMARTpool siRNA specifically targeting mouse Hmgn1 or Hmgn2 (GE Dharmacon) were transfected into ESCs using Lipofectamine RNAiMAX reagent (Invitrogen). Cells were split and transfected again after first 48 h, and harvested after another 48 h. For HMGN1/2 rescue experiments, 1 μg pCI plasmid vectors (Promega) carrying the expression cassette of human HMGN1 or HMGN2 or HMGN1SE mutant were transiently transfected into DKO ESCs using Mouse ES Cell Nucleofector Kit (Lonza) according to the manufacturer's instruction. Cells were harvested after 48 h for western blot and ChIP assay.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!