Dermalife k lifefactors

Viral stocks utilized in this study include HSV-1 wildtype strain KOS and recombinant strain K26 which contains VP26-GFP fusion gene (a generous gift from Dr. Prashant Desai, Johns Hopkins University, Baltimore, MD), and HSV-2 wildtype strains HG52 and 186. Viral titers were determined by titration in Vero cells. Primary human adult keratinocytes were purchased from Lifeline Cell Technology (#FC-0025). Cells were cultured in DermaLife^® Basal Medium with DermaLife K LifeFactors (Lifeline Cell Technology Cat # LL-0007) as recommended by the manufacturer. Human diploid fibroblasts were cultures from skin biopsies as previously described (25 (link)), and used at low passage. CRISPR-Cas9 IFI16 knockout and Cas9 control cell lines were generated in human foreskin fibroblasts (Hs27 cell line; ATCC, CRL-1634, RRID: CVCL_0335) as described previously (26 (link)), using the IFI16 gRNA sequence: GUUCCGAGGUGAUGCUGGUU and maintained under puromycin selection (1 µg/mL) in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% (vol/vol) fetal bovine serum (FBS) and penicillin-streptomycin.

Residual gingival tissue from molar extractions (see above) was enzymatically digested with dispase II (4 mg/ml) for 30 min at 37 °C. After filtering through a 70 μm cell strainer and washing with PBS by centrifugation (400 × g for 5 min), the cell pellet is resuspended in complete DermaLife Basal medium supplemented with DermaLife K LifeFactors (Lifeline Cell Technology). Cell are grown on Collagen-A-coated (0,1 mg/mL Collagen A) tissue culture vessels under standard culture conditions.

For co-culture of human dental pulp-derived cells and cells of epithelial origin (gingivium or skin derived) the condensates produced described by the method above are transferred at day 2 to 5 in a composite medium appropriate for both cell types (DMEM high glucose (with FCS)) and DermaLife Basal medium supplemented with DermaLife K LifeFactors (Lifeline Cell Technology); 1:1). A single cell suspension of epithelial cells in a ratio of 1:4 related to the initial cell number used for mesenchymal condensation was added and the resulting mixture was cultured under non-adherent conditions. To ensure constant culture conditions, medium was changed regularly every 1–3 days.