The largest database of trusted experimental protocols

Sh mapk1

Manufactured by GenePharma
Sourced in China

Sh-MAPK1 is a laboratory equipment product. It functions as a genetic tool for the silencing or knockdown of the MAPK1 gene. MAPK1 is a serine/threonine-protein kinase that plays a crucial role in the MAPK/ERK signaling pathway, which is involved in various cellular processes such as cell proliferation, differentiation, and survival.

Automatically generated - may contain errors

2 protocols using sh mapk1

1

Modulating MAPK1 and KCNQ1OT1 with shRNA and miR-212-3p in HK-2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Short hairpin RNA (sh-RNA) targeting MAPK1 (sh-MAPK1) or KCNQ1OT1 (sh-KCNQ1OT1) and negative controls (sh-NC), MAPK1 overexpression vector (pcDNA3.1/MAPK1) and the negative control (empty pcDNA3.1 vector), miR-212-3p mimics/inhibitor and the negative control (NC mimics/inhibitor) were obtained from GenePharma (Shanghai, China). Sequences of plasmids used for cell transfection are provided in Table 1. HK-2 cells were seeded in 6-well plates and grown for 24 h until the cell density reached 30–50%. Later, Lipofectamine 2000 (Thermo Fisher Scientific, USA) was used to transfect shRNAs (50 nM), mimics/inhibitors (40 nM) and pcDNA3.1 vectors (10 nM) into HK-2 cells according to the manufacturer’s protocols. After 48 hours, the efficiency of cell transfection was verified by RT-qPCR.

Sequences of plasmids used for cell transfection

NameSequence (5ʹ→3ʹ)
sh-MAPK1GGACCTCATGGAAACAGATCTTTCAAGAGAAGATCTGTTTCCATGAGGTCCTTTTTT
sh-NCAGATGACACTATAGGTCCGACTTCAAGAGAGTCGGACCTATAGTGTCATCTTTTTTT
sh-KCNQ1OT1GGTGTTACGACTTGTTGTATTCAAGAGATACAACAAGTCGTAACACC TTTTTT
sh-NCGATGTGATCATTCTGGTGTTTCAAGAGAACACCAGAATGATCACATCTTTTTT
miR-212-3p mimicsUAACAGUCUCCAGUCACGGCC
NC mimicsCGCCACCUAAGUAGUGCACCU
miR-212-3p inhibitorGGCCGUGACUGGAGACUGUUA
NC inhibitorAGGUGCACUACUUAGGUGGCG
+ Open protocol
+ Expand
2

Characterizing CRNDE and MAPK1 in HepG2 and Huh-7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
PcDNA3.1‐CRNDE, sh‐CRNDE, pcDNA3.1‐MAPK1, sh‐MAPK1, miR‐217 mimics, anti‐miR‐217 and negative control were provided by GenePharma (Shanghai, China). Transfection of HepG2 and Huh‐7 cells was conducted using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Transfected cells were cultured in 6‐well plates. After 48‐h cultivation, the cells were collected for subsequent analyses.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!