In vitro transcription system

Digoxigenin-labeled probes were synthesized using an in vitro transcription system (Roche). Whole-mount in situ hybridization was performed as described [26 (link)]. Images were captured with a Leica CTR5000 microscope (Wetzlar, Germany). For gene expression analyses, whole body homogenates of embryos at 5.3 days post fertilization (dpf) and homogenates of livers dissected from 8 month old male adult zebrafish were used. Total RNA was extracted with Trizol (Thermo Fisher, Cat#15596026) following the manufacturer’s protocol. cDNA was prepared with an RNA to cDNA EcoDry kit (Takara-Clontech, Cat#639543) and qPCR was performed with a SYBR fast qPCR kit (Kapa, Cat#KK4602), using a Rotor Gene Q thermocycler (Qiagen). The qPCR primers used in these studies were: beta-actin (GenBank, NM_131031), 5’GGCTTCTGCTCTGTATGG3’ and 5’AACGCTTCTGGAATGACTAA3’; lcat (GenBank, XM_001332792), 5’CGGTTACTTCCACACTATG3’ and 5’TACTCCTCCTGCTCATTC3’; cetp (GenBank, XM_009293552), 5’CCATAATGACGGACGATT3’ and 5’ATGACTCTGACTGATGTG3’; apoa1 (GenBank, NM_131128), 5’GCACTGACTCTTCTCTTG3’ and 5’CTGATCCTTGACCTGGTT3’; apoe (GenBank, NM_131098), 5’CCTCTGATGCTGCTGGTC3’ and 5’CTGAGTGCTGCGTTCCTT3’; apoB (GenBank, XM_689735), 5’AGAGGCTTAGAGATATGCTGAGT3’ and 5’GGCGTGGATGTTGCTTGA3’; and mtp (GenBank, NM_212970), 5’GATAACGGCAAACTCTACA3’ and 5’GCTAATCCTGAATCCAACA3’.

ISH for Fgf7 and Fgf10 was performed as described previously [18 (link)]. The pcDNA3 plasmid containing a cDNA fragment of mouse Fgf7 (nucleotides 193–769; GenBank accession no. NM008008.4) and Fgf10 (nucleotides 533–1135; GenBank accession No. NM008002.4) was constructed. Single-stranded digoxigenin-labelled RNA probes were generated using an in vitro transcription system (Roche, Switzerland, 11,277,073,910). Frozen sections were rehydrated, treated with HCl (Nacalai Tesque Inc., Japan, 28514-75), digested in Proteinase K solution (Roche, Switzerland, 03115844001), post-fixed, treated in acetic anhydride solution (Nacalai Tesque Inc., Japan, 00211 − 95), and hybridized overnight at 60 and 65 °C with probes for Fgf7 and Fgf10, respectively. After extensive rinsing and washing, the sections were subjected to immunohistochemistry using an alkaline phosphatase–conjugated anti-digoxigenin antibody (Roche, Switzerland, 1,093,274,910). The sections were then treated with nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate solution (Roche, Switzerland, 11,383,213,001 and 11,383,221,001) for color development. Images were acquired using a microscope (BZ-X710; Keyence).