DNA was extracted from peripheral blood leucocytes by a standardized salting-out procedure.25 (link) Genotyping of the Val66Met polymorphism (rs6265) of the BDNF gene was determined using the forward (GGCTTGACATCATTGGCTGAC) and reverse (GGTCCTCATCCAACAGCTCTT) primers and probes in the Human Custom TaqMan Genotyping Assay 40x (Applied Biosystems, Foster City, CA, USA). One allele probe was labeled with VIC dye and the other was labeled with FAM dye. The reactions were conducted in a 96-well plate with a total reaction volume of 20 µl, using 2 ng of genomic DNA, TaqMan Genotyping Master Mix 1x (Applied Biosystems), and a custom TaqMan genotyping assay 1x. The plates were then positioned in a real-time PCR thermal cycler (7500 Fast Real PCR System; Applied Biosystems) and heated for 10 min at 95 °C, followed by 45 cycles of 95 °C for 15 s and 60 °C for 1 min. Fluorescence data files from each plate were analyzed using automated allele-calling software (SDS 2.1; Applied Biosystems).
Human custom taqman genotyping assay 40x
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Human Custom TaqMan Genotyping Assay 40x is a pre-designed and pre-formulated real-time PCR (polymerase chain reaction) assay. It is used to detect and quantify specific genetic sequences or single nucleotide polymorphisms (SNPs) in human samples.
Automatically generated - may contain errors
2 protocols using human custom taqman genotyping assay 40x
1
BDNF Genotyping by TaqMan Assay
2
DIO2 Gene Genotyping in Peripheral Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from peripheral blood leukocytes by a standardized procedure. Primers and probes contained in the Human Custom TaqMan Genotyping Assay 40x (Applied Biosystems, Foster City, CA, USA) were used for genotyping our samples. The predesigned TaqMan SNP Genotyping Assay® C_15819951_10 was used to analyze the DIO2 gene (rs225014 [Thr92Ala]) SNP (Applied Biosystems, Foster City, CA, USA). One allelic probe was labeled with VIC dye and the other with FAM dye. The reactions were conducted in a 96-well plate with a total 5 µL reaction volume using 2 ng of genomic DNA, TaqMan Genotyping Master Mix 1x (Applied Biosystems, Waltham, MA, USA), and Custom TaqMan Genotyping Assay 1x. The plates were then positioned in a real-time PCR thermal cycler (7500 Fast Real PCR System; Applied Biosystems) and heated for 10 min at 95 °C, followed by 50 cycles of 95 °C for 15 s and 60 °C for 90 s. Fluorescence data files from each plate were analyzed using automated allele-calling software (SDS 2.1; Applied Biosystems).
Patients were classified as Ala/Ala, Thr/Ala, or Thr/Thr genotypes. All amplification reactions were performed twice. The genotyping success was over 95%, with a calculated error rate based on PCR duplicates of 0%.
Patients were classified as Ala/Ala, Thr/Ala, or Thr/Thr genotypes. All amplification reactions were performed twice. The genotyping success was over 95%, with a calculated error rate based on PCR duplicates of 0%.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!