Cropseq guide puro

Manufactured by Addgene

The CROPseq-Guide-Puro is a plasmid that can be used for CRISPR-based genetic screens. It contains a puromycin resistance gene for selection of transduced cells.

Automatically generated - may contain errors

Lab products found in correlation

Opti mem 1, by Thermo Fisher Scientific (2 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions) Fetal calf serum (fcs), by Merck Group (2 mentions) Lenticas9 blast, by Addgene (2 mentions) Pmdlg prre, by Addgene (2 mentions) Pmd2 g, by Addgene (2 mentions) Prsv rev, by Addgene (2 mentions) Novaseq 6000, by Illumina (1 mentions) T4 dna ligase, by Addgene (1 mentions) Vvpa 1002, by Lonza (1 mentions) Ghost dye 710, by Cytek Biosciences (1 mentions) Lentiguide puro, by Addgene (1 mentions) Maxiprep, by Qiagen (1 mentions) Lentimph v2, by Addgene (1 mentions) Lenti icas9 neo, by Addgene (1 mentions) Lenti dcas vp64 blast, by Addgene (1 mentions)

Spelling variants of this product

CROPseq-Guide-Puro gRNAbackbone (2 citations)

7 protocols using cropseq guide puro

Pooled CRISPR Screening of Mouse Dendritic Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The gRNAs were cloned into CROPseq-Guide-Puro (Addgene, #86708)^{44 (link)}. All the gRNAs were pooled together in equal concentrations. BMDCs were transduced and selected with puromycin in the experiments that are shown in Supplementary Fig. 5 and Fig. 4. In the experiment in Fig. 3, the cells were not selected.
For the experiment shown in Supplementary Fig. 5, we used gRNA-Cd86, gRNA-CD274, and gRNA-non-targeting. On day 8, cells were incubated with CD86 and PD-L1 barcoded antibodies and washed three times with cold PBS.
For the double targeting Cebpb and Nr4a3 experiment in Fig. 3, gRNA-Cebpb and gRNA-Nr4a3 were cloned into the CROPseq-Guide-Puro (Addgene #86708).
For the experiment in Fig. 4, a pool of 32 gRNAs was cloned into CROPseq-Guide-Puro (Addgene #86708). HashTag Oligonucleotide (HTO) antibodies and anti-CD86 and anti-PD-L1 ADT TotalSeq™ antibodies were used. After three washes with cold PBS, 50,000 cells were loaded on seven channels of 10X Genomics Chromium single-cell 3′ chip.
HTO and ADT sequences were recovered from the cDNA using the manufacturer protocol^{12 (link)}. gRNA sequences were recovered from the cDNA libraries.
CDNA, ADT, HTO, and the gRNA libraries were sequenced using Novaseq6000 (Illumina).

Xia L., Komissarova A., Jacover A., Shovman Y., Arcila-Barrera S., Tornovsky-Babeay S., Jaya Prakashan M.M., Nasereddin A., Plaschkes I., Nevo Y., Shiff I., Yosefov-Levi O., Izhiman T., Medvedev E., Eilon E., Wilensky A., Yona S, & Parnas O. (2023). Systematic identification of gene combinations to target in innate immune cells to enhance T cell activation. Nature Communications, 14, 6295.

+ Open protocol

+ Expand

Engineered AsCas12a Lentiviral Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The protein-coding sequence of AsCas12a (RRID:Addgene_84739) was subcloned into a lentiviral expression vector, EFS-FLAG-P2A-Puro (RRID:Addgene_108100). NLS sequences were incorporated into overlapping DNA oligonucleotides homologous to the Cas-containing backbone by PCR. AsCas12a (E174R, S542R) was cloned in two rounds of mutagenesis PCR on the completed WT AsCas12a-6xNLS vector to generate a final lentiviral vector, opAsCas12a (pRG232, Addgene_149723). All vector cloning was performed using the In-Fusion HD Cloning system (TBUSA).
The AsCas12a crRNA expression vector (pRG212, Addgene_149722) was built by replacing the sgRNA region in the CROPseq-Guide-Puro plasmid (RRID:Addgene_86708) with AsCas12a DRs flanking a short filler that contained BsmbI restriction sites. In addition, the puromycin resistance cassette was replaced with EGFP-P2A-Neomycin, subcloned from LRG2.1-Neomycin (RRID:Addgene_125593).
The resulting pRG212 (EFS-GFP-P2A-Neo-U6-crRNA) vector was BsmbI-digested, and crRNAs were ligated in with T4 DNA ligase (NEB). Single-crRNA and dual-crRNA were cloned by annealing and phosphorylating complementary DNA oligonucleotides with T4 polynucleotide kinase (NEB).

Gier R.A., Budinich K.A., Evitt N.H., Cao Z., Freilich E.S., Chen Q., Qi J., Lan Y., Kohli R.M, & Shi J. (2020). High-performance CRISPR-Cas12a genome editing for combinatorial genetic screening. Nature Communications, 11, 3455.

+ Open protocol

+ Expand

Lentiviral Particle Production in HEK293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T cells were plated onto six-well plates at 1.2 million cells per well in 2 ml of lentivirus packaging medium (Opti-MEM I (Gibco cat. no. 51985-034), 5% FCS (Sigma), 200 μM sodium pyruvate (Gibco cat. no. 11360-070), no antibiotics). The next morning, cells were transfected with lipofectamine 3000 (Invitrogen cat. no. L3000015) using 1.7 μg of CROPseq-Guide-Puro (containing single gRNAs or libraries) or LentiCas9-Blast (Addgene 52962), and 0.9 μg each of the three packaging plasmids pMDLg/pRRE (Addgene 12251), pRSV-Rev (Addgene 12253), and pMD2.G (Addgene 12259). The medium was exchanged for fresh lentivirus packaging medium 6 h after the transfection. Supernatant containing viral particles was harvested at 24 h and 48 h, pooled, and passed through a 0.45 μm filter to remove cells. Further concentration of viral particles was not required. Virus was stored at -80 °C. One vial was subsequently thawed for estimating the virus titer.

Datlinger P., Rendeiro A.F., Schmidl C., Krausgruber T., Traxler P., Klughammer J., Schuster L.C., Kuchler A., Alpar D, & Bock C. (2017). Pooled CRISPR screening with single-cell transcriptome read-out. Nature methods, 14(3), 297-301.

+ Open protocol

+ Expand

Single-Cell CRISPR Screening of CD8+ T Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The backbone plasmid used to clone the CROP-Seq library was CROPseq-Guide-Puro, purchased from Addgene (Addgene. Plasmid #86708). This library consisted of 20 gene targets (2 guides per gene selected from hits in the GW screen) and 8 non-targeting control guides, for a total of 48 guides (Table S5). Oligos for these library guides were purchased from Integrated DNA Technologies (IDT) and cloned into the CROPseq-Guide-Puro plasmid backbone using the methods described by Datlinger et al. (Datlinger et al., 2017 (link)). Lentivirus was produced from this pooled plasmid library and used to transduce CD8+ T cells from two healthy donors, as above. 48 hours after transduction, 1e6 cells were resuspended in P3 buffer and 3μL of Cas9 (Stock 40μM) was added. Cells were transferred to a 96 well electroporation cuvette plate (Lonza, cat #VVPA-1002) for nucleofection using the pulse code EH115. 24 hours post nucleofection, cells were treated with 2.5ug/mL Puromycin for three days, and subsequently sorted for live cells using Ghost Dye 710 (Tonbo Biosciences, Cat #13–0871). Two days post sorting, cells were restimulated as above. 36 hours post restimulation, cells were collected, counted, and prepared for Illumina sequencing by Chromium^™ Single Cell 3’ v2 (PN-120237), as per manufacturer protocol.

Shifrut E., Carnevale J., Tobin V., Roth T.L., Woo J.M., Bui C., Li P.J., Diolaiti M., Ashworth A, & Marson A. (2018). Genome-wide CRISPR Screens in Primary Human T Cells Reveal Key Regulators of Immune Function. Cell, 175(7), 1958-1971.e15.

+ Open protocol

+ Expand

Lentiviral Particle Production in HEK293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Generating CRISPR Library Constructs

Cited 4 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

sgRNA sequences in custom libraries are available in Additional file 3: Table S2. sgRNAs were designed using CRISPick algorithm [14 (link)]. For each gene, we chose top scoring 5 sgRNAs (based on CRISPick scores). Libraries were prepared as previously described [16 (link), 22 (link), 73 (link)]. Briefly, oligonucleotide pools (CustomArray) contained the sgRNA sequence appended to BsmBI cutting sites and overhang sequences for PCR amplification. The final sequence obtained is: AGGCACTTGCTCGTACGACGCGTCTCACACCG [20nt spacer]GTTTCGAGACGTTAAGGTGCCGGGCCCACAT. Following PCR amplification with Fwd: 5′-AGGCACTTGCTCGTACGACG-3′, Rev: 5′-ATGTGGGCCCGGCACCTTAA-3′ primers, the PCR product was cloned via Golden Gate assembly into BsmBI-digested lentiGuide-Puro vector (Addgene# 52,963) for CRISPRko and CRISPRi libraries and into pXRP502 (Addgene #96,923) for CRISPRqtl oligos were cloned into CROPseq-Guide-Puro (Addgene#86,708). Ligated libraries were electroporated into NEB5α electrocompetent cells (NEB), plasmid DNA was extracted using Qiagen Maxi Prep. For each library preparation, a 1000X representation was ensured.

Tuano N.K., Beesley J., Manning M., Shi W., Perlaza-Jimenez L., Malaver-Ortega L.F., Paynter J.M., Black D., Civitarese A., McCue K., Hatzipantelis A., Hillman K., Kaufmann S., Sivakumaran H., Polo J.M., Reddel R.R., Band V., French J.D., Edwards S.L., Powell D.R., Chenevix-Trench G, & Rosenbluh J. (2023). CRISPR screens identify gene targets at breast cancer risk loci. Genome Biology, 24, 59.

+ Open protocol

+ Expand

Lentiviral Plasmid Construction and Characterization

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Lenti-idCas9-KRAB-neo and Lenti-idCas9-VP64-neo plasmids were generated from Lenti-iCas9-neo (Addgene, plasmid # 85,400), TRE-KRAB-dCas9-IRES-GFP (Addgene, plasmid # 85,556) and lenti dCAS-VP64_Blast (Addgene, plasmid # 61,425). The lentiMPH v2-EGFP plasmid was generated by replacing hygromycin with EGFP from lentiMPH v2 (Addgene, plasmid # 89,308). CROPseq-i-sgRNA-BFP and CROPseq-a-sgRNA-BFP backbones were generated from CROPseq-Guide-Puro (Addgene, plasmid # 86,708). CROPseq-i-NC-BFP and CROPseq-i-KRAS-BFP plasmids were generated from CROPseq-i-sgRNA-BFP backbone with i-NC or i-KRAS, respectively. CROPseq-a-NC-BFP. CROPseq-a-KRAS-1-BFP and CROPseq-a-KRAS-2-BFP plasmids were generated from CROPseq-a-sgRNA-BFP backbone with a-NC, a-KRAS-1, or a-KRAS-2, respectively. The sgRNA sequences are listed in Supplementary Table 8. Lenti-iCas9-neo was a gift from Qin Yan, TRE-KRAB-dCas9-IRES-GFP was a gift from Eric Lander, lenti dCAS-VP64_Blast and lentiMPH v2 were gifts from Feng Zhang, and CROPseq-Guide-Puro was a gift from Christoph Bock [35 (link)–39 (link)].

Jamalzadeh S., Dai J., Lavikka K., Li Y., Jiang J., Huhtinen K., Virtanen A., Oikkonen J., Hietanen S., Hynninen J., Vähärautio A., Häkkinen A, & Hautaniemi S. (2024). Genome-wide quantification of copy-number aberration impact on gene expression in ovarian high-grade serous carcinoma. BMC Cancer, 24, 173.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!