Plasmids encoding EGFP-tagged WT LC3B and phospho-mutants (T50A and T50E) were obtained as described6 (link). Plasmids encoding HA-tagged LC3B proteins were generated by replacing the EGFP sequence in the EGFP plasmids with an HA-tag followed by a Tobacco etch virus protease sequence recognition site and a Flag-Tag (Genewiz) using AgeI and HindIII (New England Biolabs). Lipidation-deficient LC3B proteins were generated by mutagenic PCR using Q5 Hot Start High-Fidelity Master Mix (New England Biolabs) to introduce the GGG to GCT change that leads to a glycine to alanine (G120A) mutation. Bacterial expression plasmids encoding His-tagged WT, T50A, and T50E LC3B proteins were produced as described6 (link). A plasmid encoding mCherry-tagged FYCO1 was generated by cloning the mCherry-FYCO1 gene from a pBABE-puro-mCherry-FYCO1 plasmid (Dr. Dario Alessi, University of Dundee) into the plasmid backbone of EGFP-LC3B (Addgene) by amplification of fragments using Q5 Hot Start High-Fidelity Master Mix and ligation using a Gibson Assembly Master Mix (New England Biolabs). pLKO.1-puro plasmids encoding scrambled shRNA and five FYCO1-targeted shRNAs were purchased from Sigma Aldrich. For details on oligonucleotides refer to Table S1 .
Egfp lc3b
Manufactured by Addgene
EGFP-LC3B is a fluorescent protein-tagged microtubule-associated protein 1A/1B-light chain 3 (LC3) construct. LC3 is a key protein involved in autophagy, a cellular process that degrades and recycles damaged organelles and other cellular components. The EGFP tag allows for visualization and tracking of LC3 within cells.
Automatically generated - may contain errors
Lab products found in correlation
Human specific p130cas sirna, by Merck Group (2 mentions)
Murine specific p130cas sirna, by Merck Group (2 mentions)
Plko 1 puro plasmid, by Merck Group (1 mentions)
Gibson assembly master mix, by New England Biolabs (1 mentions)
Q5 hot start high fidelity master mix, by New England Biolabs (1 mentions)
Gapdh antibody 60004 1 ig, by Proteintech (1 mentions)
Irdye 800cw anti rabbit igg, by LI COR (1 mentions)
Pepstatin a p 5318, by Merck Group (1 mentions)
Irdye 800cw goat anti mouse igg 926 32210, by LI COR (1 mentions)
E64d e8640, by Merck Group (1 mentions)
Sirna transfection protocol, by Santa Cruz Biotechnology (1 mentions)
Taggfp2 lc3 lentivirus, by Merck Group (1 mentions)
5 protocols using egfp lc3b
1
Plasmid Construction for LC3B and FYCO1 Studies
2
Antibody-based Autophagy Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies including anti-LC3B (ab48394), anti-SQSTM1 (ab109012), anti-EEA1 (ab2900), anti-Rab5 (ab18211), anti-Rab11a (ab65200), anti-Lamp1 (ab24170), anti-Lamp 2b(ab18529) were purchased from Abcam, GAPDH antibody (60004-1-Ig) was purchased from Proteintech, anti-NSs antibody was generated in our laboratory. E64d (E8640) and pepstatin A (P5318) were purchased from Sigma Aldrich. Conjugated antibodies including the IRDye 800CW goat anti-mouse IgG (926-32210) and IRDye 800CW anti-rabbit IgG (926–32211) were purchased from LI-COR. Fluorescent secondary antibodies including Alexa Fluor 488-conjugated anti-mouse (SA00006-1) and anti-rabbit IgG (SA00006-2), Alexa Fluor 594-conjugated anti-mouse (SA00006-3) and anti-rabbit IgG (SA00006-4) were purchased from Proteintech. DAPI reagent (C0060) was purchased from Solarbio. EGFP-LC3B (11546, deposited by Toren Finkel) was purchased from Addgene. NS-GFP vector was re-constructed by cloning the SFTSV-NSs open reading frame into the pEGFP-N1 vector (preserved in our laboratory). Both siRNA directed against LC3B (GCUUACAGCUCAAUGCUAA) and negative control RNA was synthesized by GenePharma.
3
Silencing p130cas in Cancer Cell Lines
4
Transfection and Autophagy Induction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were seeded and incubate at 37° C in a CO2 incubator until the cells were 70% confluent. Cells were transfected with validated siRNA, TagGFP2-LC3 Lentivirus (Millipore, 17–10193) or EGFP-LC3 B (Addgene, 11546), following the manufacturer's siRNA Transfection Protocol (Santa Cruz Biotechnology), Lentiviral Transduction Protocol (Millipore) or Xfect™ Transfection Reagent Protocol (Clontech Laboratories, PT5003-2), respectively.
5
Silencing p130cas in Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EGFP-LC3B (Addgene plasmid #11546; http://n2t.net/addgene:11546 ) was provided by Dr. Karla Kirkegaard. Human-specific p130cas siRNA was purchased from Sigma-Aldrich (St. Louis, MO) and used to silence p130cas expression in ovarian cancer cell lines (target sequence: CAGCATCACGCAGGGCAA). Murine-specific p130cas siRNA was purchased from Sigma-Aldrich and used to silence expression in MOECs (target sequence: TTGACTAATAGTCTACATTA). Control non-targeting (“scramble”) siRNA (target sequence: AATTCTCCGAACGTGTCACGT) was confirmed to have no sequence homology with any known human or murine mRNA by BLAST analysis. Information on sequences is available in Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!