The largest database of trusted experimental protocols

Typhon fla9500

Manufactured by GE Healthcare
Sourced in Japan

The Typhon FLA9500 is a fluorescence imager used for the detection and analysis of fluorescently labeled samples. It is designed to capture high-quality images of gels, blots, and other fluorescent samples. The Typhon FLA9500 features a range of excitation and emission wavelengths to accommodate various fluorescent dyes and labels.

Automatically generated - may contain errors

2 protocols using typhon fla9500

1

EMSA Analysis of SRF Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
Nuclear extracts from C17.2 cells were prepared as described previously20 (link). The nuclear extracts and 32P-labeled oligonucleotide (SRF consensus probe: GAGTCCCTATAAAGAGGGGTTC, underlining indicates SRF consensus binding site in −28 to −19 bp of the CCL4 gene promoter) were incubated in EMSA binding buffer (10 mM Tris-HCl [pH 7.5], 4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl) at 25 °C for 30 min. DNA-protein complexes were resolved on a 4.5% polyacrylamide gel in 0.5 × TBE (Tris-borate-EDTA) buffer. Gels were dried and subjected to autoradiography. Image analysis was performed using Typhon FLA9500 (GE Healthcare Japan, Tokyo, Japan).
+ Open protocol
+ Expand
2

Primer Extension Scaffold Assembly

Check if the same lab product or an alternative is used in the 5 most similar protocols
For assembly of scaffolds used for primer extension experiments, the DNA and RNA oligonucleotides (1 mL, 20 mM each) were mixed and incubated at 95 C for 3 min. The mixture was placed immediately on ice for 1 min. Afterwards, 3 mL of 23 HB buffer were added, and the mixture was incubated at room temperature for at least 10 min. Prior to scaffold assembly, the used RNA was radioactively labelled on the 5 0 -end with [g-32P]ATP (10 mCi/mL, Hartmann Analytic) and T4 PNK (NEB), following purification via PAGE. The annealed scaffold was diluted to 2 mM with transcription reaction buffer (TRB) (20 mM Hepes, pH 7.6, 60 mM (NH 4 ) 2 SO 4 , 10 mM MgSO4, 10% glycerol, 2 mM DTT). 1 mL of diluted scaffold was incubated with 1 mL of Pol III (4 mM, also diluted in TRB) for at least 10 min at RT. Primer extension was initiated via addition of 7 mL TRB, supplemented with NTPs (1 mM each, final concentration). The reaction was incubated at 28 C for 20 min and stopped by adding 3 mL of formamide and boiling for 4 min. The reaction was subjected to PAGE using a denaturing (8M Urea) 17% polyacrylamide TBE gel. Radioactive signal was captured with a phosphor-imaging screen (Fujifilm) and detected with a Typhon FLA9500 (GE Healthcare) instrument.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!