Log In Sign up
The largest database of trusted experimental protocols

G 32 p atp

Manufactured by PerkinElmer
Visit Supplier
Sourced in United States

[g-32P]-ATP is a radioactive nucleotide analog used as a tracer in molecular biology and biochemistry applications. It is a synthetic compound containing the radioactive isotope phosphorus-32 (32P) incorporated into the gamma-phosphate group of adenosine triphosphate (ATP). This product is commonly used for labeling and detection of nucleic acids and proteins in various experimental techniques.

Automatically generated - may contain errors

Lab products found in correlation

T4 polynucleotide kinase, by Thermo Fisher Scientific (3 mentions) T4 polynucleotide kinase, by PerkinElmer (2 mentions) Dna pk inhibitor, by Bio-Techne (1 mentions) Signatect dna dependent protein kinase assay system, by Promega (1 mentions) Axio imager z1 microscope, by Zeiss (1 mentions) Thrombin, by Merck Group (1 mentions) Phosphorimage system typhoon fla7000, by Cytiva (1 mentions) Gel dryer, by Bio-Rad (1 mentions) Amersham hyperfilm ecl, by GE Healthcare (1 mentions) Imagescanner 3, by GE Healthcare (1 mentions) Dynabead, by Thermo Fisher Scientific (1 mentions) Antarctic phosphatase, by New England Biolabs (1 mentions) Murine rnase inhibitor, by New England Biolabs (1 mentions) T4 pnk, by New England Biolabs (1 mentions) Turbo dnase, by Thermo Fisher Scientific (1 mentions) T4 pnk, by Thermo Fisher Scientific (1 mentions) Dna and rna oligonucleotides, by Integrated DNA Technologies (1 mentions) Cmpcpp, by Jena Biosciences (1 mentions) Rntps, by Promega (1 mentions) T4 polynucleotide kinase, by New England Biolabs (1 mentions)

18 protocols using g 32 p atp

1

Electrophoretic Mobility Shift Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Electrophoretic mobility shift assays (EMSAs) were performed as described in (Enoru-Eta et al., 2000) (link).
DNA probes were 32 P-labeled for visualization. To obtain the labeled probes, DS459 and EP190 were 5'end-labeled with g-32 P-ATP (Perkin Elmer) using T4 polynucleotide kinase (Thermo Scientific). Labeled DS459 and unlabeled DS460 were used in a PCR with the respective constructs (pBS-down35, pBS-up35 and proD-mKate2) as template. Labeled EP190 was used in combination with EP191 in a PCR using S. acidocaldarius genomic DNA as a template. The resulting fragments with a length between 242 and 264 bp were then purified by acrylamide gel electrophoresis. EMSAs were performed with in each binding reaction approximately 0.1 nM 32 P-labeled DNA probe and an excess (25 µg/ml) of non-specific competitor DNA (sonicated salmon sperm DNA). Binding reactions were prepared in binding buffer (20 mM Tris-HCl (pH 8.0), 1 mM MgCl2, 0.1 mM DTT, 12.5% glycerol, 50 mM NaCl, 0.4 mM EDTA) and allowed to equilibrate at 37°C for one hour prior to electrophoresis on a native 6% polyacrylamide gel. Visualization was performed by autoradiography.
Sybers D., Joka Bernauw A., El Masri D., Ramadan Maklad H., Charlier D., De Mey M., Bervoets I, & Peeters E. (2022). Engineering transcriptional regulation in Escherichia coli using an archaeal TetR-family transcription factor. Gene, 809.
+ Open protocol
+ Expand
2

Quantitative Assay of DNA-PKcs Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
Residual DNA DSBs were quantified using foci assays as described previously (19) with detection of histone gH2AX (clone JBW301; Millipore) and 53PB1 (#NB-100-304; Novus Biologicals) in at least 50 nuclei per single experiment using an Axio Imager Z.1 microscope (Zeiss). Acute DSBs per Gy are approximately 35 to 40 foci per cell and increase linearly with the irradiation dose (20) . Thus, to ascertain microscopic assessment/quantification of distinct and individual foci cells were irradiated with a dose of 2 Gy.
In vitro DNA-PKcs kinase assay DNA-PKcs kinase activity was quantified with a SignaTECT DNA-Dependent Protein Kinase Assay System (Promega) using purified DNA-PKcs (30 units, #V5811; Promega) and Surv-EGFP [survivin wild type (wt) inserted into pEGFP-N1] immunoprecipitated at 1 hour after 4 Gy irradiation. One mmol/L DNA-PK inhibitor (KU 0060648; Tocris) treated preparations were used as a negative control. (g-32 P) ATP (Perkin Elmer) was quantified by a Fujifilm BAS-1500 Imager (GE Healthcare Life Sciences) and evaluated by using TINA Image Analysis Environment software (OSMIA Project, EU IST Program).
Güllülü Ö., Hehlgans S., Mayer B.E., Gößner I., Petraki C., Hoffmann M., Dombrowsky M.J., Kunzmann P., Hamacher K., Strebhardt K., Fokas E., Rödel C., Münch C, & Rödel F. (2021). A Spatial and Functional Interaction of a Heterotetramer Survivin-DNA-PKcs Complex in DNA Damage Response. Cancer research, 81(9).
+ Open protocol
+ Expand
3

Radioactive Kinase Assay Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
[g 32 P]ATP (specific activity 111 TBq/mmol) was from Perkin Elmer (Boston, MA). Fusicoccin (FC) was prepared according to Ballio et al. (1968) . The catalytic subunit of protein kinase A, thrombin, diacylglycerol (DAG), phosphatidylcholine (PC) were from Sigma (St. Louis, MO). Chemicals for gel electrophoresis were from Bio-Rad (Hercules, CA).
Muzi C., Camoni L., Visconti S, & Aducci P. (2016). Cold stress affects H+-ATPase and phospholipase D activity in Arabidopsis. Plant physiology and biochemistry : PPB, 108.
+ Open protocol
+ Expand
4

Bacterial Virulence and Oxidative Stress Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bacterial strains were inoculated into 8-week-old cabbage (Brassica oleraceae cv. Jingfeng No 1.) for virulence assay or in planta growth. Bacterial susceptibility to oxidative stress was tested by treatment of the strains using 1.2 or 15 mM H 2 O 2 . The relative survival rate and the inhibition zone were measured after treatment.
Protein Expression, Purification, and In Vitro Phosphorylation Assay Prokaryotic expression system of pET30a and E. coli BL21(DE3) was used for protein expression. Inverted membrane extraction, purification of recombinant proteins, and in vivo phosphorylation assay were conducted as a previous study described (Wang et al., 2014) . PcrK autokinase activity was detected by co-incubating with 10 mCi [g-32 P]-ATP (PerkinElmer, Norwalk, CT, USA) at 28 C in 20 mL autophosphorylation buffer. The isotopic signal was detected by a PhosphorImage system Typhoon FLA7000 (Amersham Biosciences, Bath, UK).
Wang F.F., Cheng S.T., Wu Y., Ren B.Z, & Qian W. (2017). A Bacterial Receptor PcrK Senses the Plant Hormone Cytokinin to Promote Adaptation to Oxidative Stress. Cell reports, 21(10).
+ Open protocol
+ Expand
5

Nanodiscs-Based Protein Phosphorylation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Tar-Nanodiscs had a Tar:CheA:CheW ratio of 20:1:5, as described by Li et al. 2011 . For MCP2901-Nanodiscs, the ratio of MCP2901:CheA ct :CheW ct was optimized and was set at 4:1:5. The Nanodiscs and downstream components mixture were incubated at 228C for 1 h. When required, ligands were added and subsequently incubated for another 15 min. To initiate the phosphorylation reaction, 5 lCi [g-32 P]-ATP (PerkinElmer, Massachusetts, USA) were added to 50 ll mixtures and after 30 or 60 s time intervals, 10 ll samples were collected and reactions were stopped by addition of 5 ll sample buffer. The proteins were separated by 15% SDS-PAGE and exposed to a phosphor screen for imaging.
Huang Z., Ni B., Jiang C.Y., Wu Y.F., He Y.Z., Parales R.E, & Liu S.J. (2016). Direct sensing and signal transduction during bacterial chemotaxis toward aromatic compounds in Comamonas testosteroni. Molecular microbiology, 101(2).
+ Open protocol
+ Expand
6

Oligonucleotide Synthesis and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Oligonucleotides were synthesised using b-cyanoethyl phosphoramidite chemistry {Beaucage, 1981 #6; Sinha, 1984 #171}. Fully deprotected oligonucleotides were purified by gel electrophoresis on a 10%(w/v) polyacrylamide gel in 90 mM Tris.borate (pH 8.5), 2 mM EDTA (TBE buffer) containing 8M urea. Oligonucleotides were detected by UV shadowing and recovered by electroelution and ethanol precipitation. Concentration estimated by absorbance at 280 nm.
Oligonucleotides labelled with fluorescein at their 3'-termini were synthesized using 6-fluorescein CPG columns (Glen Research 20-2961). Oligonucleotides were radioactively [5'-32 P]-labelled using [g-32 P] ATP (Perkin Elmer) using T4 polynucleotide kinase (Fermentas) for 30 min at 37ºC in in 50 mM Tris (pH 7.6), 10 mM MgCl 2 , 5 mM DTT, 0.1 mM spermidine. All DNA sequences used are tabulated in Table S1.
Song J., Freeman A.D.J., Knebel A., Gartner A., & Lilley D.M.J. (2020). Human ANKLE1 is a nuclease specific for branched DNA.
+ Open protocol
+ Expand
7

Small RNA Binding Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Small RNA EMSA was performed as previously described (Yang et al., 2010) with minor modifications. Single strands of miR160, miR160* (complementary sequences of miR160), miR164, and miR164* (complementary sequences of miR164) (GenePharma, Shanghai, China) were synthesized and end-labeled with [g-32 P]-ATP (PerkinElmer, Waltham, MA) using T4 polynucleotide kinase (cat. no. M0201s; New England Biolabs) at 37 C for 30 min. These single-stranded miRNAs were hybridized to double-stranded forms (miR160/miR160* and miR164/miR164*) by heating for 20 min at 60 C and cooling for 1 h at room temperature. Pri-miRNA166c was produced by in vitro transcription and radiolabeled with [a-32 P]-UTP, as described above. These radiolabeled RNA constructs were incubated with increasing amounts of MBP-FHA2, His-HYL1, or His-DCL1-PRR for 1-2 h in EMSA binding buffer (10 mM Tris-HCl [pH 7.9], 50 mM NaCl). After the reactions, RNA sample buffer and formamide were added to the mixtures, and the reaction mixtures were loaded into a Tris-Borate-EDTA (TBE; pH 8.0) PAGE gel (5%-13% gradient) at ice-cold temperature. After electrophoresis, the gel was dried in a gel dryer (Bio-Rad) at 60 C for 30 min. The RNA-protein binding products were detected using a phosphorimager (Typhoon IP, GE Healthcare).
Park S.J., Choi S.W., Kim G.M., Møller C., Pai H.S, & Yang S.W. (2021). Light-stabilized FHA2 suppresses miRNA biogenesis through interactions with DCL1 and HYL1. Molecular plant, 14(4).
+ Open protocol
+ Expand
8

Nuclear Protein Extraction and EMSA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Nuclear protein extraction and EMSA from skeletal muscles and L6 cells were carried out as previously described [6, 16] . Briefly, double-stranded oligonucleotide containing the putative CRE sequence of the Slc2a4 promoter gene was end-labeled with T4 polynucleotide kinase (Invitrogen, Carlsbad, CA, USA) and g -32 P ATP (PerkinElmer Life, Waltham, MA, USA). Nuclear proteins were incubated with the labeled oligonucleotide probe in a buffer, for 20 min at room temperature. Competition binding experiments were performed under the same conditions, with the addition of 10-fold molar excess of native and mutant (Mut1 and Mut2) unlabeled oligonucleotides. The oligonucleotides spanned the -489/-467 sequence of the Slc2a4 gene, and were described in the results. For antibody competition assay, nuclear proteins were incubated for 1.5 h with 10 µg of anti-CREB/CREM antibody (ab5803, Abcam, Cambridge, MA, USA), before adding the probe. DNA/protein complexes were electrophoresed on 4% non-denaturing polyacrylamide gel at 4°C. The gel was dried and exposed to a hyperfilm (Amersham Hyperfilm ECL, GE Healthcare Life Sciences) for 3 days at -80°C. The blots were analyzed by scanner densitometry (ImageScanner III, GE Healthcare, Sweden). Results were expressed as arbitrary units.
Alves-Wagner A.B., Yonamine C.Y., de Fatima L.A., Festuccia W, & Machado U.F. (2019). Sympathetic Regulation of Slc2a4 Gene Expression: Participation of a Putative cAMP Responsive Element (CRE) Site in the Slc2a4 Promoter. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 52(3).
+ Open protocol
+ Expand
9

CTCF Crosslinking and Immunoprecipitation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
PAR-CLIP was performed as in (Saldaña-Meyer et al., 2014 (link)) with some modifications. Briefly, mESC C59 Halo-wt-CTCF and mESC C59D2 Halo-ΔRBRi-CTCF cells were grown under standard conditions and pulsed with 400 mM 4-SU (Sigma) for 2 h. After washing the plates with PBS, cells were cross-linked with 400 mJ/cm2 UVA (312 nm) using a Stratalinker UV cross-linker (Stratagene). Whole nuclear lysates (WNLs) were obtained by fractionation and nuclei were then incubated for 10 min at 37°C in an appropriate volume of CLIP buffer (20 mM HEPES at pH 7.4, 5 mM EDTA, 150 mM NaCl, 2% EMPIGEN) supplemented with protease inhibitors, 20 U/mL Turbo DNase (Life technologies), and 200 U/mL murine RNase inhibitor (New England Biolabs). After clearing the lysate by centrifugation, immunoprecipitations were carried out using 200 μg of WNLs in the same CLIP buffer for 4 h at 4°C and then added protein G-coupled Dynabeads (Life Technologies) for an additional hour. Contaminating DNA was removed by treating the beads with Turbo DNase (2 U in 20 mL). Cross-linked RNA was labeled by successive incubation with 5 U of Antarctic phosphatase (New England Biolabs) and 5 U of T4 PNK (New England Biolabs) in the presence of 10 mCi [g-32P] ATP (PerkinElmer). Labeled material was resolved on 8% Bis-Tris gels, transferred to nitrocellulose membranes, and visualized by autoradiography.
Hansen A.S., Hsieh T.H., Cattoglio C., Pustova I., Saldaña-Meyer R., Reinberg D., Darzacq X, & Tjian R. (2019). Distinct Classes of Chromatin Loops Revealed by Deletion of an RNA-Binding Region in CTCF. Molecular cell, 76(3), 395-411.e13.
+ Open protocol
+ Expand
10

MIWI CLIP-seq for Spermatid piRNA Profiling

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
MIWI CLIP-seq was performed as described40 (link). In brief, isolated round spermatids from adult C57BL/6J mice were UV-irradiated (254 nm) at 400 mj in a 15-cm plate before immunoprecipitation using a highly specific anti-MIWI antibody. Immunoprecipitated RNA-protein complexes were digested with micrococcal nuclease, labeled with [g-32P]-ATP (PerkinElmer) by T4 PNK (Fermentas), and isolated by SDS-PAGE, from which [32P]-labeled RNA-protein bands were cut for extracting RNAs for linker ligation, PCR amplification, and deep sequencing.
For each read, the first 4 random index sequences were removed and appended to the read name. The resulting read was 36 nt in length. The 3′-adaptor sequence (CTCGTATGCCGTCTTCTGCTTG) was trimmed and short reads (< 16 nt) were filtered out. Reads were then mapped to the mouse genome (mm9) using bowtie37 with parameters: “-l25 -n2 -k101 -m100 -e200 --best --strata --sam --phred33-quals”. Mapped reads with ≤ 1 mismatch were chosen for downstream analysis. Reads with lengths of 25-33 nt were classified as piRNAs, and longer reads are considered as MIWI targets.
Zhang P., Kang J.Y., Gou L.T., Wang J., Xue Y., Skogerboe G., Dai P., Huang D.W., Chen R., Fu X.D., Liu M.F, & He S. (2015). MIWI and piRNA-mediated cleavage of messenger RNAs in mouse testes. Cell Research, 25(2), 193-207.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!