Pcr topo 4.0 vectors

To verify the splicing variants of M₄ in human brain, we performed exon-to-exon PCR using 3 brain total RNA with M₄ gene specific sense primers binding at exon 1 using SMART RACE cDNA Amplification Kit (Clonetech) and Advantage 2 PCR Kit (Clonetech). The human brain total RNA was reverse-transcribed to cDNA by MMLV reverse transcriptase (Clontech) according to the manufacturer’s protocol. Based on RNA sequencing, we designed primer pairs to verify the M₄ splice variants using Platinum TaqDNA polymerase (Invitrogen). The control primer set to detect the canonical M₄ transcript was TCCCACAATCGCTATGAGACG (forward) and CACCACAAACTGCCAGAACAAG (reverse). Junction primers were designed to bridge between the short and long transcripts (GTCCGTCCCGCCGTCTGTCT (forward) and CGTTGCTCACCACGTAGTCC (reverse)). The PCR conditions were 94°C for 3 min, 35 cycles of 94°C for 30 sec, 60°C for 30 sec, 72°C for 1 min, and 72°C for 10 min after the last cycle. The PCR products were cloned into E. coli by PCR-TOPO 4.0 vectors (InvitrogenTM) and sequenced [18 (link)]. All PCR results were confirmed in separate PCR assays and Sanger sequencing.

To identify the 3’ ends of GAD2 transcript in human brain, we performed 3’ RACE, using fetal and adult brain poly A+ RNA with GAD2 gene specific sense primers binding at exon 1. We used the SMART RACE cDNA Amplification Kit (Clontech) and Advantage 2 PCR Kit (Clonetech) for these assays. Commercial human fetal and adult brain poly A+ RNAs (Clontech) were reverse-transcribed to cDNA by MMLV reverse transcriptase (Clontech) according to the manufacturer’s protocol. The PCR amplification profile was 94°C for 2 min, 45 cycles of 94°C for 30 s, 68–72°C for 30s, 68°C for 2–6 min, and 68°C for 10min after the last cycle. Based on known GAD2 gene exons (NM_001134366.1) and 3r RACE results, we designed primer pairs to amplify full length and portion of GAD2 transcripts using Platinum TaqDNA polymerase (Invitrogen). The PCR conditions were 94°C for 3 minutes, 30 cycles of 94°C for 30 sec, 56°C for 30 sec, 72°C for 1–5 minute, and 72°C for 10 minutes after the last cycle. RACE and end-to-end PCR products were cloned into E. Coli by PCR-TOPO 4.0 vectors (Invitrogen^TM) and sequenced. All PCR results were confirmed in separate PCR assays and Sanger sequencing.