For all of the trials, moribund oysters from the selected and control lines were sampled for the detection of OsHV-1 and V. aestuarianus DNA. Total DNA was extracted from tissue fragments (mantle + gills) using the QIAgen (Hilden, Germany) QIAamp tissue mini kit combined with the QIAcube automated system according to the manufacturer’s protocol. The total DNA amount was adjusted to 5 ng/µL following Nanodrop (Thermo Scientific) measurement.
A real-time PCR assay was conducted on the MX3000 and MX3005 Thermocyclers (Agilent) using the Brilliant III Ultrafast kit (Stratagene). Each reaction was run in duplicate in a final volume of 20 µL containing the DNA sample (5 µL at a 5 ng/µL concentration), 200 nM of each primer (for OsHV-1, DPF 5′ ATT GAT GATGTG GAT AAT CTG TG 3′ and DPR 5′ GGT AAA TAC CAT TGG TCT TGTTCC 3′ [26 (link)] and for V. aestuarianus, DNAj-F 5′ GTATGAAATTTTAACTGACCCACAA3′ and DNAj-R 5′ CAATTTCTTTCGAACAACCAC 3′ [27 (link)]) and 200 nM of an oligonucleotide probe (for V. aestuarianus DNAj, probe 5′ TGGTAGCGCAGACTTCGGCGAC). The real-time PCR cycling conditions were as follows: 3 min at 95 °C, followed by 40 cycles of amplification at 95 °C for 5 s and 60 °C for 20 s. For OsHV-1 DNA quantification, melting curves were also plotted (55-95 °C) to ensure that a single PCR product was amplified for each set of primers. Negative controls (without DNA) were included.
A real-time PCR assay was conducted on the MX3000 and MX3005 Thermocyclers (Agilent) using the Brilliant III Ultrafast kit (Stratagene). Each reaction was run in duplicate in a final volume of 20 µL containing the DNA sample (5 µL at a 5 ng/µL concentration), 200 nM of each primer (for OsHV-1, DPF 5′ ATT GAT GATGTG GAT AAT CTG TG 3′ and DPR 5′ GGT AAA TAC CAT TGG TCT TGTTCC 3′ [26 (link)] and for V. aestuarianus, DNAj-F 5′ GTATGAAATTTTAACTGACCCACAA3′ and DNAj-R 5′ CAATTTCTTTCGAACAACCAC 3′ [27 (link)]) and 200 nM of an oligonucleotide probe (for V. aestuarianus DNAj, probe 5′ TGGTAGCGCAGACTTCGGCGAC). The real-time PCR cycling conditions were as follows: 3 min at 95 °C, followed by 40 cycles of amplification at 95 °C for 5 s and 60 °C for 20 s. For OsHV-1 DNA quantification, melting curves were also plotted (55-95 °C) to ensure that a single PCR product was amplified for each set of primers. Negative controls (without DNA) were included.