Dna extraction kit

In this experiment, South China No. 8 (SC8) cassava and MeFtsZ2-1 overexpression cassava variety, developed at the School of Life Sciences of Hainan University, were employed as experimental materials. The MeFtsZ2-1 gene sequence and cloning method were provided by Mengting Geng [41 ]. The method of MeFtsZ2-1 transgenic cassava was performed according to the method of Yajie Wang [42 ]. We extracted cassava DNA and RNA according to the DNA extraction kit (Vazyme, Nanjin, China) and the RNA extraction kit (Vazyme, Nanjin, China). The extracted cassava DNA and RNA were used as templates for RT-PCR and RT-qPCR analysis. According to the results of PCR and quantitative real-time PCR, we selected OE#2 as the follow-up experimental material. Leaves (the fourth leaves under the apical buds of 8-month-old cassava) and tuberous roots (8-month-old cassava) were harvested from the tropical crop experimental base of Hainan University (30°52’N 121°54’E), with each sample having three biological replicates. Following collection, each sample was divided into three equal parts. One portion of the samples was rapidly frozen using liquid nitrogen and stored at -80 °C for subsequent RNA extraction and transcriptome sequencing. The second portion of leaves was fixed with 2.5% glutaraldehyde, while the third portion, constituting fresh samples, was used to measure various physiological indices.

Lentiviral shRNA was constructed by molecularly cloning target oligonucleotides into the Tetracycline-on (Tet-on) puromycin-resistant plasmid (Addgene, #21915). The DNA extraction of plasmids was performed using DNA extraction kit (Vazyme, DC112-01). The lentivirus was packaged by transfecting objective plasmids with packaging vectors (psPAX2 and pMD2.G) and PEI MAX solution (Polysciences, #24765) in HEK293T cells. The ratio of DNA mass to PEI MAX (1mg/ml stock solution) is 1:3. Afterwards, the virus supernatant was collected, filtered with 0.45μm strainer, concentrated with PEG6000 (Sigma, #81253), resolved in PBS and then aliquoted for subsequent transfection.
Cells were transfected at an approximately multiplicity of infection (MOI) 1.5 to 3 after 48 hours, and the positive STCs were selected after 72 hours of 2μg/mL puromycin (YEASEN, 60210ES25) treatment. 1μg/mL of doxycycline (Dox) was used to induce ALKBH5 knockdown in Tet-on STCs. The target oligonucleotides are listed in Supplemental Table 3.

C57/BL6 wild-type mice were sourced from the Beijing Vital River Experimental Animals Centre in Beijing. Sestrin1^−/−(Sesn1^−/−), Sestrin2^−/−(Sesn2^−/−), and Sestrin3^−/−(Sesn3^−/−) were generated using the CRISPR/Cas9 system. DNA for genotyping was extracted from the mouse ears by a DNA extraction kit (Vazyme, Jiangsu China) and then amplified by primers with specific sequences (Supplementary Table 1). The amplified DNA was subjected to agarose gel electrophoresis and visualized under ultraviolet light. Homozygous knockout mice were obtained through the breeding of heterozygous knockout mice. Genotyping was performed on each knockout mouse before they were used in the experiments.
The mice were maintained under a 12-hour light/dark cycle at a temperature of 20–25 °C and provided with free access to food and water. All animal experiments were approved by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University. The litter size of the knockout mice was determined by mating them with wild-type male mice, and the number of pups in each litter was counted immediately after birth through visual inspection.

DNA were extracted from treated cells with DNA extraction kit (DC112-01, Vazyme Biotech). The genomic DNA was diluted to 250 ng/μL in 100 μL nuclease-free water. Then, 100 μL 2× DNA denaturation buffer was added and incubated at 95 °C for 10 min following by putting 2 μL DNA with different concentration on nylon membrane. The nylon film was cross-linked with UV (1200 J/m²) for 15 min after drying the nylon membrane. Anti-5-mC antibody was used to incubate the membrane after blocked with 5% BSA overnight at 4 °C. Wash the membrane with Tris-buffered saline for 3 times. Images were captured by Chemiluminescence Imaging System (Tanon, Shanghai, China) after the secondary antibody incubated.

We constructed C42B EnzaRes Dox/shNME2 cells by infecting C42B EnzaRes cells with pLKO-Tet-On-shNME2 virus followed by continuous puromycin selection. The lentiviral shRNA plasmid was constructed by inserting target shNME2 oligonucleotide sequence into Tet-pLKO-puro (Addgene, #21915) plasmid. For generating NME2 CRISPR KO cells, sgRNA oligonucleotide sequences were cloned into pLentiCRISPR-v2 plasmid (Genscript).
For both NME2 KD and KO cells, virus was generated as follows: plasmid DNA was extracted using a DNA extraction kit (Vazyme, DC112–01). The lentivirus was packaged by transfecting the plasmids with packaging vectors (psPAX and pMD2.G) and Lipofectamine 2000 (Invitrogen, #11668-019) in Opti-MEM media (Gibco) into HEK293T cells. Afterward, the virus supernatant was collected, filtered with a 0.45 μm strainer, concentrated with PEG6000 (Sigma, #81253), resolved in PBS and then aliquoted for subsequent transfection. Cells were infected with viruses and selected for 72 h with puromycin (2 μg/mL, Sigma-Aldrich, P8833). The following oligonucleotide sequences were used: TCATGGCAGTGATTCAGTAAA for the shNME2 sequence (flanked by start ACCGGT and end GAATTC sequences for a total of 33 bp) and CACCTTCATCGCCATCAAGC for sgNME2_V1 and GCACTCACCATGGCCACAAC for sgNME2_V2. Cells transfected with the second sgRNA guide, sgNME2_V2, were used for further in vitro studies.

Lentiviral shRNA or sgRNA plasmids were constructed by inserting target oligonucleotides into pLKO.1 (Addgene, #10878) or lentiGuide-Puro (Addgene, #52963) plasmids, respectively. Plasmid DNA was extracted using a DNA extraction kit (Vazyme, DC112–01). The lentivirus was packaged by transfecting the plasmids with packaging vectors (psPAX and pMD2.G) and PEI MAX solution (Polysciences, #24765) into HEK293T cells. Afterward, the virus supernatant was collected, filtered with a 0.45 μm strainer, concentrated with PEG6000 (Sigma, #81253), resolved in PBS and then aliquoted for subsequent transfection. Cells were infected with viruses and selected for 72 hours with puromycin (0.5–2 μg/mL, Yeasen, 60210ES25), blasticidin (5–20 μg/mL, YEASEN, 60218ES60), or G418 (100–250 μg/mL, Yeasen, 60220ES03). The target oligonucleotides are listed in Supplemental Table 2.