The largest database of trusted experimental protocols

9 protocols using active cdc42 detection kit

1

Quantification of Active Rho GTPases

Check if the same lab product or an alternative is used in the 5 most similar protocols
Levels of GTP-bound Rac1, GTP-bound CDC42 and GTP-bound RhoA were detected using an Active Rho Detection Kit (Active Rac1 Detection Kit; Active CDC42 Detection Kit; Cell Signaling Technology) according to the manufacturer's protocol. Briefly, GST-Rhotekin-RBD fusion protein or GST-PAK-PBD was used to bind activated forms of GTP-bound Rho and GTP-bound Rac1/CDC42, which were then immunoprecipitated with glutathione resin. The level of Rho activation or Rac1/CDC42 activation was then determined by western blotting using Rho/Rac1/CDC42 rabbit antibody, respectively.
+ Open protocol
+ Expand
2

Quantifying Activated Cdc42 in HUVECs

Check if the same lab product or an alternative is used in the 5 most similar protocols
HUVECs were seeded at a density of 2 × 105 in a 100 mm dish. The next day, cells were transfected with empty vector, DIAPH1 WT, or DIAPH1 double negative mutant for 24 hr and further starved overnight. Then, cells were treated with PBS or CCN1 (10 ng/mL) for 30 min. Protein lysate was collected by centrifugation at 16,000 × g at 4C for 15 min. Active Cdc42 was extracted from the lysate per the manufacturer’s protocol. Briefly, an equal amount of protein was used for GTPase assay (Active Cdc42 detection kit, 8819, Cell Signalling Technology). GST-PAK1-PBD fusion protein was used to bind the activated form of GTP-bound Cdc42. The level of activated Cdc42 was checked by WB with Cdc42 antibody (Cell Signalling Technology).
+ Open protocol
+ Expand
3

Inhibition of Fibrosis and Inflammation in Hypoxia

Check if the same lab product or an alternative is used in the 5 most similar protocols
FG-3019 (10 mg/kg) and control IgG (10 mg/kg)—both administered intraperitoneal every week at initiation of hypoxia exposure (Wang et al., 2011 (link))—were the kind gift of FibroGen Inc. (San Francisco, CA). Bleomycin Sulfate, ML141, and dichloromethylenediphosphonic acid disodium salt (clodronate) was purchased through MilliporeSigma. Lipids and cholesterol for liposome production were bought from Avanti Polar Lipids. EBM-2 culture media (Lonza), with EGM-2 bulletkit, was utilized for all in vitro experiments. Primer sequences are as follows: CTGF forward primer GGGAGAACTGTGTACGGAGC; CTGF reverse primer AGTGCACACTCCGATCTTGC; CD11b forward primer ATGGACGCTGATGGCAATACC; CD11b reverse primer TCCCCATTCACGTCTCCCA; 18S forward primer ACCTGGTTGATCCTGCCAGTAG; and, 18S reverse primer TTAATGAGCCATTCGCAGTTTC. Antibodies used in this study were: anti-GFP (Aves), MECA-32 (BD Biosciences), CTGF (BD Biosciences), CD11b (Abcam), F4/80 (BD Biosciences), CD31 (Santa Cruz Biotechnology), and GAPDH (Abcam). Antibodies for flow cytometry used in this study were: CD45 (FITC; BioLegend), CD11b (APC-Cy7; BioLegend), and IgG2 (isotype control; BioLegend). Active Cdc42 detection kit was purchased through Cell Signaling Technology. Secondary fluorescent antibodies were from Jackson Immunoresearch. Refer to Supplementary Table 1 for full details of antibody catalog number and dilutions.
+ Open protocol
+ Expand
4

Quantifying Active Cdc42 Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
Active Cdc42 level was detected by using Active Cdc42 Detection Kit (Cell Signaling Technologies, #8819). Briefly, GST-PAK1-PBD fusion proteins were used to bind GTP-bound Cdc42, which was then immunoprecipitated with glutathione resin and detected by western blotting.
+ Open protocol
+ Expand
5

Cdc42 Activation Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The active Cdc42 Detection Kit (Cell Signaling) was used according to the manufacturer's instructions. Briefly, GTP-bound Cdc42 was isolated with glutathione agarose beads bound to the p21-binding domain of PAK1 via a GST tag, and then identified by immunoblotting of eluted proteins with an antibody for Cdc42.
+ Open protocol
+ Expand
6

Pak2 Regulation of Schwann Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pak2+/+ and Pak2−/− Schwann cells were plated onto poly-L-lysine (PLL)-coated 100 mm plates and grown in Dulbecco’s modified Eagle medium (DMEM)/F12 supplemented with 10% fetal bovine serum (FBS) until they reached 80% confluency. To induce serum and mitogen starvation, cells were washed twice with pre-warmed Hanks’ Balanced Salt Solution (HBSS) and incubated in DMEM/F12 containing 0.5% FBS (starvation medium) for 20 h. After the incubation, three replicates of each plate were treated for 1 h at 37°C and 5% CO2 using either starvation medium with a vehicle (PBS plus 0.02% FBS; mock medium), 50 ng/ml Nrg1, or 2 μM PrPC peptide.
Following the stimulation period, cells were washed twice with PBS containing phosphatase inhibitors (Cat. No. 5872, Cell Signaling) and lysed with 1× lysis buffer. Total protein concentration was determined using the BCA assay (Prod. No. 23225, Thermo Scientific). The active GTPase pull-down assay was performed according to the manufacturer’s instructions for the active RAC1 detection kit (Cat. No. 8815, Cell Signaling) and active CDC42 detection kit (Cat. No. 8819, Cell Signaling), with samples treated with GTPγS (positive control) and GDP (negative control). The immunoprecipitated materials and total protein samples were then prepared for immunoblot analysis.
+ Open protocol
+ Expand
7

Quantifying Rac1, RhoA, and Cdc42 Activities

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rac1 activity assays were performed using Rac1 assay reagent (GST-PAK1-PBD on glutathione beads) according to the manufacturer’s instructions (Active Rac1 Activation Assay kit, Cell Signaling). RhoA activity assays were performed using Rho activation assay beads (GST-Rhotekin-RBD on glutathione beads) according to the manufacturer’s instructions (Active Rho Detection kit, Cell Signaling). Cdc42 activity assay was performed using Active Cdc42 detection kit according to the manufacturer’s instructions (Active Cdc42 detection kit, Cell Signaling).
+ Open protocol
+ Expand
8

Rho GTPase Activity Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
RhoA activity assays were performed using Rho activation assay beads (GST-Rhotekin-RBD on glutathione beads) according to the manufacturer’s instructions (Active Rho Detection kit, Cell Signaling). Rac1 and Cdc42 activity assays were performed using Rac1/Cdc42 assay reagent (GST-PAK1-PBD on glutathione beads) according to the manufacturer’s instructions (Active Rac1 Activation Assay kit, EMD Millipore and Active Cdc42 Detection kit, Cell Signaling).
+ Open protocol
+ Expand
9

Antibody Validation and Cellular Signaling Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibody against CIP4 (Cat:612556) was purchased from BD Biosciences (NY, USA). Antibodies against GAPDH (Cat:60004), Cdc42 (Cat:10155), Cortactin (Cat:11381), Histone H3 (Cat:17168), FLAG tag (Cat:66008) were purchased from Proteintech (Illinois, USA). Antibodies against p65 (Cat:8242), p-p65 (Cat:3033), the Active Cdc42 Detection Kit (Cat: 8819) were purchased from Cell Signaling Technology (Massachusetts, USA). Antibodies against His tag (Cat:0287R) and GST tag (Cat:33007M) were purchased from Bioss (Beijing, China). The Cdc42 inhibitor ML141 and the NF-κB signaling inhibitor QNZ were purchased from Selleck Chemicals (Shanghai, China). The NF-κB signaling activator LPS was purchased from Sigma (Missouri, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!