Escherichia coli bl21

The pET-28a(+)-His-NONO plasmid was purchased from GenePharma. The expression vector was transfected into Escherichia coli BL21 (TransGen Biotech; Beijing, China). The obtained strains were grown in LB medium supplemented with 0.1 mg/mL kanamycin at 37 °C with shaking at 200 rpm. Protein expression was induced with 0.5 mM isopropyl-β-D-thiogalactopyranoside (Solarbio; Beijing, China) and purification was performed with the His-Tagged Protein Purification Kit (CoWin Bio; Cambridge, MA, USA).
SPR was performed with SensiQ (The Pioneer platform, ForteBio; Freemont, CA, USA). First, the SPR chip (Hiscap biosensor, ForteBio) was activated with 1 mM NiCl₂, and 50 μg/mL His-NONO was immobilized on the chip. Small molecule (300 µM Auranofin) binding activities were generated with the SPR system, and the binding signal was exhibited by the response (RU) value. The data were normalized to control and analyzed with Qdat (ForteBio). Binding curves were subsequently generated.

The coding region of MdCNR8 was cloned into PET32a vector, and the coding region of MdSCE1 was cloned into PGEX 4X-1 vector. The recombinant vectors of MdCNR8-PET32a and MdSCE1-PGEX 4X-1 and empty vector of PGEX 4X-1 were transformed into Escherichia coli BL21 (TransGen, Beijing, China). To produce glutathione-S-transferase (GST) and His-fusion protein, we treated Escherichia coli BL21 with 0.1-mm isopropyl β-D-1-thiogalactopyranoside for 6 h at 37°C. Pull-down assays were carried out as previously described (Ma et al., 2019a (link)). Finally, we detected the pellet fraction via immunoblotting with anti-His and anti-GST antibody (Abmart, Shanghai, China).

The ORFs of MrANR and MrLAR were amplified from Biqi fruit (113 DAFB). The PCR product was purified and subcloned into the BamHI and SalI sites of the pET32a expression vector (Novagen, Gibbstown, NJ, USA). After confirmation by sequencing, the recombinant vectors were introduced into Escherichia coli BL21 (TransGen, Beijing, China). The bacteria were grown in Luria-Bertani ampicillin (100 μg mL⁻¹) medium at 37°C overnight until the OD600 reached 0.6, at which point 1 mM IPTG (isopropyl β-D-1-thiogalactopyranoside) was added to induce protein expression at 120 rpm for 48 h at 16°C. The recombinant proteins with a 6 × His tag at the N terminus were purified with the His-tagged protein purification kit (CWBIO, Beijing, China), according to the manufacturer's instructions. Purity was then checked by SDS-PAGE.

The cDNA of the AsCDA gene was amplified by PCR using the AsCDA1-F (BamHI:GGATCCACAACTGCTTACTTACGCGGA) and AsCDA1-R (HindIII:AAGCCTGTCCTGGTGCGCAGGAAAATG), verified by DNA sequencing, cloned into the pET-28a expression vector and transformed into Escherichia coli BL21 (TransGen Biotech, Beijing, China). The expression of the recombinant AsCDA was induced by the addition of isopropyl b-D-thiogalactoside (IPTG, final concentration of 1mM) in Luria–Bertani medium (LB medium, containing 50 ng/mL kanamycin) [58 (link)]. After overnight induction at 16 °C, the bacterial cells were collected, resuspended in lysis solution, and sonicated for 30 min. The sediment and supernatant were collected after centrifugation for 20 min (4 °C, 12,000 rpm/min). Recombinant AsCDA was purified by the AKTA-purifier protein purification system and Histidine Ni-Sepharose™ Fast Flow, analyzed by SDS-PAGE on a 12% gel after Coomassie brilliant blue R-250 staining. Protein concentration was determined by the bicinchoninic acid method using BSA as a standard.

The CsARF5-HIS fusion protein and biotin labeled probes were prepared for EMSAs. The CsARF5-HIS fusion protein was obtained by inducing Escherichia coli BL21 (TransGen Biotech, Beijing, China) with isopropyl β-D-thiogalactoside (IPTG). The biotin-labeled probes were synthesized by Sangon Biotech (Shanghai, China) Co., Ltd. To perform the EMSAs, the fusion protein was mixed with the probe and incubated at 24 °C for 30 min. The protein-probe mixture was separated by nondenatured acrylamide gel electrophoresis.